si:dkey-208c22.2

Ensembl ID:
ENSDARG00000076994
ZFIN ID:
ZDB-GENE-081104-363
Human Orthologue:
GPR124
Human Description:
G protein-coupled receptor 124 [Source:HGNC Symbol;Acc:17849]
Mouse Orthologue:
Gpr124
Mouse Description:
G protein-coupled receptor 124 Gene [Source:MGI Symbol;Acc:MGI:1925810]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31669 Essential Splice Site Available for shipment Available now
sa8749 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31669
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112331 Essential Splice Site 354 1115 8 19
ENSDART00000131546 Essential Splice Site 278 973 7 18
Genomic Location (Zv9):
Chromosome 8 (position 39139946)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 38018749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCTTCTGTCCGGAGCAGAAAGTGAACAACAATCGAGGGGAGTTCAGG[T/G]AGGGGAGGTGTCCTAATGCTTTATCTGTATCCAAATAAGAATTCTCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8749
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112331 Nonsense 998 1115 19 19
ENSDART00000131546 Nonsense 922 973 18 18
Genomic Location (Zv9):
Chromosome 8 (position 39116051)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 37994854
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTGGCACTGATGGCAACCCAGTTTGTGTTTGTTGGGCTGTGGTGCTG[C/A]GGCGCTATGGCARTTTGGCATGTGGATAGAGAGCGGAAACTCTTCARTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link