dolk

Ensembl ID:
ENSDARG00000076991
ZFIN ID:
ZDB-GENE-070410-59
Description:
dolichol kinase [Source:RefSeq peptide;Acc:NP_001103954]
Human Orthologue:
DOLK
Human Description:
dolichol kinase [Source:HGNC Symbol;Acc:23406]
Mouse Orthologue:
Dolk
Mouse Description:
dolichol kinase Gene [Source:MGI Symbol;Acc:MGI:2677836]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12253 Essential Splice Site Available for shipment Available now
sa43570 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12253
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112460 Essential Splice Site None 524 1 2
Genomic Location (Zv9):
Chromosome 21 (position 4797805)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4375217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATATTTCCCTTTGTTCGAGAATTAAGCGACAAATAAGAGAGAAAYAGG[T/A]AAGAATAATYGTTATWTTGTGCAATGTGACGTTTYAGCGTTTGTTTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43570
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112460 Nonsense 505 524 2 2
Genomic Location (Zv9):
Chromosome 21 (position 4792292)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4369704
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTCGTGGGTGGTGGGATCCATCTCTATGGTGGCCATGTTGGAGGCCTA[T/G]ACGTCGCAGATTGACAACCTTCTGCTTCCTCTGTATCTCTACATCCTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link