LOC100330023

Ensembl ID:
ENSDARG00000076987
Human Orthologue:
SLITRK5
Human Description:
SLIT and NTRK-like family, member 5 [Source:HGNC Symbol;Acc:20295]
Mouse Orthologue:
Slitrk5
Mouse Description:
SLIT and NTRK-like family, member 5 Gene [Source:MGI Symbol;Acc:MGI:2679448]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4585 Nonsense Mutation detected in F1 DNA During 2014
sa775 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa4585
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113178 Nonsense 339 871 1 1
Genomic Location:
Chromosome 15 (position 3154076)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACCAAGTCCAAGCCCACATCTCGAATCCCRGCCAACYCCTACAACTA[C/A]GGACCCATCATTGGTTTTCAGACCAAATCCCCCGTGCCTTTGGACTGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa775
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113178 Nonsense 559 871 1 1
Genomic Location:
Chromosome 15 (position 3153417)
KASP Assay ID:
554-0680.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGAACCCTTGGGATTGCACCTGTGACGTGGTTGGCATGAAGATCTGGT[T/A]GGAGCAGCTGAATTCTGGAACGGTGGTCAATGATGTTAAATGCGTGACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/afn0ueiv