LOC794494

Ensembl ID:
ENSDARG00000076980
Human Orthologue:
PPP1R16A
Human Description:
protein phosphatase 1, regulatory (inhibitor) subunit 16A [Source:HGNC Symbol;Acc:14941]
Mouse Orthologue:
Ppp1r16a
Mouse Description:
protein phosphatase 1, regulatory (inhibitor) subunit 16A Gene [Source:MGI Symbol;Acc:MGI:1920312]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22055 Splice Site, Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111401 Splice Site, Nonsense 273 553 6 10
Genomic Location:
Chromosome 12 (position 14882489)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAGATGCTGATGGCTGGACACCACTCCATGCTGCCGCCTGCTGGGGA[C/T]AGGTGAACACTGACACATTTAGTTACCAAAGTAGCCTTAACATTCCATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wlq6oid1