ABCC8 (2 of 3)

Ensembl ID:
ENSDARG00000076973
Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 [Source:HGNC Symbol;Acc:59]
Human Orthologue:
ABCC8
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 [Source:HGNC Symbol;Acc:59]
Mouse Orthologue:
Abcc8
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 Gene [Source:MGI Symbol;Acc:MGI:1352629]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11238 Nonsense Available for shipment Available now
sa4041 Nonsense Mutation detected in F1 DNA During 2014
sa9167 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2981 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa11238
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088191 Nonsense 156 889 5 26
Genomic Location:
Chromosome 18 (position 48933727)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTAYTGGACTTTRGCTTTTGTCACCAAAACCATCMAGTTTGTGAAATA[C/A]GATGATCACGGCATCRGCCTCCKGCAGCTGCGGTTCTGCATTACGGGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4041
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088191 Nonsense 204 889 6 26
Genomic Location:
Chromosome 18 (position 48929575)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTGGTTTTTCCAGCGCTACATGTGGTTTGCRTGTCCYACTGAGGTC[A/T]AGCCTCCCGATGACCTGCAGGATCTYGGCGTTCGCTTTCTTCAGCCGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9167
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088191 Essential Splice Site 678 889 18 26
Genomic Location:
Chromosome 18 (position 48920466)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAGGAGCTGCGAGCCTCGGCCCAGCACGAGGACAACATCTGCATCAAG[G/A]TGACAGAGAAATGRTTCAACCTTNACAGTCTGTGTRAAACTAAATGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2981
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088191 Nonsense 780 889 24 26
Genomic Location:
Chromosome 18 (position 48916065)
KASP Assay ID:
554-3268.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAWTATTTTKTATTTATTTTAGTGTAAATGTCATGTTTAAAGCGTGTATC[C/T]AGTATTTTGTMTGTTGTGTGTTCAGGTATAAGGATGTGATYGAGGTTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xwu128yp