ABCC8 (2 of 3)

Ensembl ID:
ENSDARG00000076973
Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 [Source:HGNC Symbol;Acc:59]
Human Orthologue:
ABCC8
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 [Source:HGNC Symbol;Acc:59]
Mouse Orthologue:
Abcc8
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 Gene [Source:MGI Symbol;Acc:MGI:1352629]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11238 Nonsense Available for shipment Available now
sa43184 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9167 Essential Splice Site Mutation detected in F1 DNA During 2016
sa2981 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa11238
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088191 Nonsense 156 889 5 26
Genomic Location (Zv9):
Chromosome 18 (position 48933727)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50082340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTAYTGGACTTTRGCTTTTGTCACCAAAACCATCMAGTTTGTGAAATA[C/A]GATGATCACGGCATCRGCCTCCKGCAGCTGCGGTTCTGCATTACGGGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43184
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088191 Essential Splice Site 193 889 6 26
Genomic Location (Zv9):
Chromosome 18 (position 48929610)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50078345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCATCCCCTGGTCTGAGTGTTGTCTAACGGTTGTGTTTTGGTTTTTCC[A/T]GCGCTACATGTGGTTTGCGTGTCCCACTGAGGTCAAGCCTCCCGATGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9167
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088191 Essential Splice Site 678 889 18 26
Genomic Location (Zv9):
Chromosome 18 (position 48920466)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50067939
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAGGAGCTGCGAGCCTCGGCCCAGCACGAGGACAACATCTGCATCAAG[G/A]TGACAGAGAAATGRTTCAACCTTNACAGTCTGTGTRAAACTAAATGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2981
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088191 Nonsense 780 889 24 26
Genomic Location (Zv9):
Chromosome 18 (position 48916065)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50062568
KASP Assay ID:
554-3268.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAWTATTTTKTATTTATTTTAGTGTAAATGTCATGTTTAAAGCGTGTATC[C/T]AGTATTTTGTMTGTTGTGTGTTCAGGTATAAGGATGTGATYGAGGTTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link