LOC100334077

Ensembl ID:
ENSDARG00000076970
Human Orthologue:
DHRS12
Human Description:
dehydrogenase/reductase (SDR family) member 12 [Source:HGNC Symbol;Acc:25832]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19874 Nonsense Available for shipment Available now
sa39932 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa19874
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113262 Nonsense 9 325 1 10
Genomic Location (Zv9):
Chromosome 2 (position 47746016)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 47769124
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGAAGAAACAACGGTGCAACAAATGTCTCTCTACAGGAATATACTTTG[G/A]TTTATCAAGGGAATGAGGGAGTATACAAGGTAAAACTTGTCTTTGTTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39932
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113262 Essential Splice Site 64 325 3 10
Genomic Location (Zv9):
Chromosome 2 (position 47748703)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 47771811
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACACTGACCTCTTCTCAACAAGCTCCTTGAATTTTTTTCTTATTTTCCA[A/G]GGCGGCACTGTCCATATTGTCTGCCGAAACAAAGAGAAGGCTGAAAGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link