ftr22

Ensembl ID:
ENSDARG00000076969
ZFIN ID:
ZDB-GENE-070912-321
Description:
Novel protein with Zinc finger, C3HC4 type (RING finger) and B-box zinc finger domains [Source:UniPr
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2070 Essential Splice Site F2 line generated During 2014
sa5723 Essential Splice Site F2 line generated During 2014
sa19875 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2070
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098058 Essential Splice Site 17 488 2 7
ENSDART00000126740 None 86 381 1 5
ENSDART00000098058 Essential Splice Site 17 488 2 7
ENSDART00000126740 None 86 381 1 5
Genomic Location:
Chromosome 2 (position 48017958)
KASP Assay ID:
554-3389.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAYGTGATGCTGGCAGAAATGGTGGAGAAAGCAAAGGTGACAAGAAGAGC[C/T]CAAACAACTGACCCTGCTGTCAGTTACGCTGGAAGTGGAGATGTGGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5723
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098058 Essential Splice Site 17 488 2 7
ENSDART00000126740 None 86 381 1 5
ENSDART00000098058 Essential Splice Site 17 488 2 7
ENSDART00000126740 None 86 381 1 5
Genomic Location:
Chromosome 2 (position 48017958)
KASP Assay ID:
554-3389.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAYGTGATGCTGGCAGAAATGGTGGAGAAAGCAAAGGTGACAAGAAGAGM[C/T]CAAACAACTGACCCTGCTGTCAGTTACGCTGGAMGTGGAGATGTGGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19875
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098058 Nonsense 311 488 6 7
ENSDART00000126740 Nonsense 381 381 5 5
Genomic Location:
Chromosome 2 (position 48014681)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCAACATTATTTCCAATAATGAACCCAAGACGAGGGAGGAGTTTCTA[C/T]AATGTAAGTCAATGTGGACACACACAAACACACTGGTTTGGGATCCCGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xn61f548