si:dkey-202m22.8

Ensembl ID:
ENSDARG00000076964
ZFIN ID:
ZDB-GENE-091118-58
Human Orthologue:
CABLES2
Human Description:
Cdk5 and Abl enzyme substrate 2 [Source:HGNC Symbol;Acc:16143]
Mouse Orthologues:
Cables2, CT485612.1
Mouse Description:
CDK5 and Abl enzyme substrate 2 Gene [Source:MGI Symbol;Acc:MGI:2182335]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39418 Nonsense Mutation detected in F1 DNA During 2017
sa44018 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39418
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089210 Nonsense 11 457 1 10
ENSDART00000146859 Nonsense 11 505 1 9
Genomic Location (Zv9):
Chromosome 23 (position 31136624)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30971514
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCTTACTCACAGTAGAATGGCGGCCGCCGCTTGCGGTCCTCGCGGCTG[T/A]CCGAGGACTAATTCAGCCAAACCACACAAAGAACTGCTGCGAAAAAGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44018
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089210 Nonsense 195 457 5 10
ENSDART00000146859 Nonsense 250 505 4 9
Genomic Location (Zv9):
Chromosome 23 (position 31148807)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30983697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTGACTCTAAGCTAGAAGCGCAGAGACAAAGACACTCTTCTGGTGGA[G/T]GATCTGATATGGTTCCTGGACTGGAGGGTGTGGAGGTGGACTTTGGAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link