LOC560645

Ensembl ID:
ENSDARG00000076962
Human Orthologue:
GDPD5
Human Description:
glycerophosphodiester phosphodiesterase domain containing 5 [Source:HGNC Symbol;Acc:28804]
Mouse Orthologue:
Gdpd5
Mouse Description:
glycerophosphodiester phosphodiesterase domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:2686926]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12295 Nonsense Available for shipment Available now
sa13315 Essential Splice Site Available for shipment Available now
sa13021 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12295
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112375 Nonsense 63 579 2 15
Genomic Location:
Chromosome 15 (position 28793950)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTCTCTTCTTCACTTTCTCCTTGTTACTGGTGTGGTTTTACTTCTGGT[G/A]GGAAGCCCACAATGACTACAGCGAGTTTAAKTGGTGAGTTMACTGGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13315
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112375 Essential Splice Site 158 579 5 15
ENSDART00000112375 Essential Splice Site 158 579 5 15
Genomic Location:
Chromosome 15 (position 28803478)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTCAGATGTGGGGAGARGAATGGGATGTAGTTTGGATTTCTCTTCAGG[T/C]AAGCWCTTGTAGACCCKGYCTACAGCTGATTTCAAGATTTTTCTCAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13021
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112375 Essential Splice Site 158 579 5 15
ENSDART00000112375 Essential Splice Site 158 579 5 15
Genomic Location:
Chromosome 15 (position 28803478)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTCAGATGTGGGGAGARGAATGGGATGTAGTTTGGATTTCTCTTCAGG[T/C]AAGCWCTTGTAGACCCKGYCTACAGCTGATTTCAAGATTTTTCTCAATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ehuuguq8