LOC560645

Ensembl ID:
ENSDARG00000076962
Human Orthologue:
GDPD5
Human Description:
glycerophosphodiester phosphodiesterase domain containing 5 [Source:HGNC Symbol;Acc:28804]
Mouse Orthologue:
Gdpd5
Mouse Description:
glycerophosphodiester phosphodiesterase domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:2686926]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12295 Nonsense Available for shipment Available now
sa13315 Essential Splice Site Available for shipment Available now
sa13021 Essential Splice Site Available for shipment Available now
sa35913 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12295
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112375 Nonsense 63 579 2 15
Genomic Location (Zv9):
Chromosome 15 (position 28793950)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29511980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTCTCTTCTTCACTTTCTCCTTGTTACTGGTGTGGTTTTACTTCTGGT[G/A]GGAAGCCCACAATGACTACAGCGAGTTTAAKTGGTGAGTTMACTGGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13315
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112375 Essential Splice Site 158 579 5 15
ENSDART00000112375 Essential Splice Site 158 579 5 15
Genomic Location (Zv9):
Chromosome 15 (position 28803478)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29521508
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTCAGATGTGGGGAGARGAATGGGATGTAGTTTGGATTTCTCTTCAGG[T/C]AAGCWCTTGTAGACCCKGYCTACAGCTGATTTCAAGATTTTTCTCAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13021
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112375 Essential Splice Site 158 579 5 15
ENSDART00000112375 Essential Splice Site 158 579 5 15
Genomic Location (Zv9):
Chromosome 15 (position 28803478)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29521508
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTCAGATGTGGGGAGARGAATGGGATGTAGTTTGGATTTCTCTTCAGG[T/C]AAGCWCTTGTAGACCCKGYCTACAGCTGATTTCAAGATTTTTCTCAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35913
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112375 Nonsense 373 579 10 15
Genomic Location (Zv9):
Chromosome 15 (position 28816384)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29534414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATTCACAGTGCACAGACCACCAGTCAATCACCCGCACCACCACGACT[G/A]GGTCAACCTCACCCTGGACACTGTTCTAGGGTCAGGAATACCACAAGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link