si:ch211-38m6.6

Ensembl ID:
ENSDARG00000076959
ZFIN ID:
ZDB-GENE-070705-179
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WVU2]
Human Orthologue:
MFSD8
Human Description:
major facilitator superfamily domain containing 8 [Source:HGNC Symbol;Acc:28486]
Mouse Orthologue:
Mfsd8
Mouse Description:
major facilitator superfamily domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:1919425]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11785 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11785
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114241 Essential Splice Site 307 484 8 13
ENSDART00000139016 Essential Splice Site 305 487 7 12
Genomic Location (Zv9):
Chromosome 2 (position 7636600)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 8054254
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTCTCACCGCTCAGTTCATCACTCTCTTCAAWCAGACAGCACTCGAG[G/A]TAAAAGTCGACAATTGCATCATATTTTGTCWGGACTGCACTGGAGGCAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link