ENSDARG00000076952

Ensembl ID:
ENSDARG00000076952
Mouse Orthologue:
Fer1l4
Mouse Description:
fer-1-like 4 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1921812]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21920 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16363 Nonsense Available for shipment Available now
sa14133 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21920
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109298 Essential Splice Site 116 1163 3 24
Genomic Location:
Chromosome 11 (position 27371610)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATTCATTTGCCCAAAAATTACAGTCCTGCTCTCTGTCTTTTCATCCA[G/T]ACAGTCGTTACTTCCAGTTACGTGCTCACATTTATCAGGCGCGGGGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16363
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109298 Nonsense 281 1163 6 24
Genomic Location:
Chromosome 11 (position 27375596)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGATGTTGACCCCARGRAAYCACAATACATGGAAGAAGAATGCTATTA[T/G]ATCATTCCTGAGGGAGTGCGACCCGTGCTGAGGAAWTACAGAATAGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14133
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109298 Nonsense 547 1163 13 24
Genomic Location:
Chromosome 11 (position 27387694)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCTTTACAAGTTTGAACTGGAAAACGACTTCAGTCAGTTCATGGACT[G/A]GTTGCACATATTTCCTGTCTACAAAGGCAAATCTAGTCTGGAAGATGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wiadk8pb