ENSDARG00000076950

Ensembl ID:
ENSDARG00000076950
Human Orthologues:
ECE1, ECE2, ECEL1, KEL, MME, MMEL1, PHEX
Human Descriptions:
endothelin converting enzyme 1 [Source:HGNC Symbol;Acc:3146]
endothelin converting enzyme 2 [Source:HGNC Symbol;Acc:13275]
endothelin converting enzyme-like 1 [Source:HGNC Symbol;Acc:3147]
Kell blood group, metallo-endopeptidase [Source:HGNC Symbol;Acc:6308]
membrane metallo-endopeptidase [Source:HGNC Symbol;Acc:7154]
membrane metallo-endopeptidase-like 1 [Source:HGNC Symbol;Acc:14668]
phosphate regulating endopeptidase homolog, X-linked [Source:HGNC Symbol;Acc:8918]
Mouse Orthologues:
Ece1, Ece2, Ecel1, Kel, Mme, Mmel1, Phex
Mouse Descriptions:
endothelin converting enzyme 1 Gene [Source:MGI Symbol;Acc:MGI:1101357]
endothelin converting enzyme 2 Gene [Source:MGI Symbol;Acc:MGI:1101356]
endothelin converting enzyme-like 1 Gene [Source:MGI Symbol;Acc:MGI:1343461]
Kell blood group Gene [Source:MGI Symbol;Acc:MGI:1346053]
membrane metallo endopeptidase Gene [Source:MGI Symbol;Acc:MGI:97004]
membrane metallo-endopeptidase-like 1 Gene [Source:MGI Symbol;Acc:MGI:1351603]
phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, v

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9150 Essential Splice Site Mutation detected in F1 DNA During 2016
sa4651 Essential Splice Site F2 line generated During 2016
sa39091 Nonsense Mutation detected in F1 DNA During 2016
sa36091 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9150
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111400 Essential Splice Site 389 793 7 18
Genomic Location (Zv9):
Chromosome 16 (position 19337347)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17367670
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GYCTCAGTCAAAAATTACTGTACCGCAGAACTACCATCCAAGAGCTTCAG[G/A]TCTGTGCTTAATCTGATTTATTATTTGTCAGATATAAATAGGTCAGTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4651
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111400 Essential Splice Site 482 793 9 18
Genomic Location (Zv9):
Chromosome 16 (position 19333128)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17363451
KASP Assay ID:
554-3529.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTCCAAATAATGAGAAACTATTCCATTGCAACAGGAGACACACAGGAG[G/A]TGGGTGGACAGTGATTATTTCTATTAATAAAAAGCATTTAAAATGAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39091
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111400 Nonsense 608 793 14 18
Genomic Location (Zv9):
Chromosome 16 (position 19326514)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17356837
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACATTTTAAATTTCTGTGTGTATGTGTGTGTGCATGTGTGTTTTAGTT[T/A]GTCTATGACTCCATTCATCTCTGGTAATGACATCATCGTCCCTGTTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36091
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111400 Nonsense 678 793 16 18
Genomic Location (Zv9):
Chromosome 16 (position 19326009)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17356332
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAAGGCAAAGAATCCAGAGACTGAGAGTCTGTGTGTGTGGTCTCATTA[T/A]CTGAGTGTGACTAAGGGTCCAGGATGGGGTGACGCATTCTATCTTCCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link