LOC565558

Ensembl ID:
ENSDARG00000076943
Human Orthologues:
LHFPL3, LHFPL4, LHFPL5
Human Descriptions:
lipoma HMGIC fusion partner-like 3 [Source:HGNC Symbol;Acc:6589]
lipoma HMGIC fusion partner-like 4 [Source:HGNC Symbol;Acc:29568]
lipoma HMGIC fusion partner-like 5 [Source:HGNC Symbol;Acc:21253]
Mouse Orthologues:
Lhfpl3, Lhfpl4, Lhfpl5
Mouse Descriptions:
lipoma HMGIC fusion partner-like 3 Gene [Source:MGI Symbol;Acc:MGI:1925076]
lipoma HMGIC fusion partner-like 5 Gene [Source:MGI Symbol;Acc:MGI:1915382]
lipoma HMGIC fusion partner-like protein 4 Gene [Source:MGI Symbol;Acc:MGI:3057108]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30899 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30899
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058321 Nonsense 53 238 1 3
Genomic Location (Zv9):
Chromosome 8 (position 7923088)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7367725
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCTGTGATCGAAGTGGTCATTCTCATTCAGCCTTCCTGGGTCGGCACA[C/T]GAGAGCTGCACTATAGAGGAGGAGGACCTGCTCCACCGACTGGGACTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity: A genome-wide association study on obesity and obesity-related traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link