LOC100330433

Ensembl ID:
ENSDARG00000076938
Human Orthologue:
TXNDC11
Human Description:
thioredoxin domain containing 11 [Source:HGNC Symbol;Acc:28030]
Mouse Orthologue:
Txndc11
Mouse Description:
thioredoxin domain containing 11 Gene [Source:MGI Symbol;Acc:MGI:1923620]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7419 Missense Mutation detected in F1 DNA During 2014
sa7305 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114770 Missense 313 727 7 14
Genomic Location:
Chromosome 1 (position 60285732)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTCCTGACCTTCCTCCCACACAATCCCCTCACAGCCAATCAGCTGCTC[G/C]ATCAGGTACATGCAGCYGGAGCCTGGAGAGTGTTTACTGCGGTATAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114770 Essential Splice Site 315 727 8 14
Genomic Location:
Chromosome 1 (position 60285715)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACACAATCCCCTCACAGCCAATCAGCTGCTCRATCAGGTACATGCAGC[C/T]GGAGCCTGGAGAGTGTTTACTGCGGTATAACAACACCGGCAGACTGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qespxuwh