LOC100330433

Ensembl ID:
ENSDARG00000076938
Human Orthologue:
TXNDC11
Human Description:
thioredoxin domain containing 11 [Source:HGNC Symbol;Acc:28030]
Mouse Orthologue:
Txndc11
Mouse Description:
thioredoxin domain containing 11 Gene [Source:MGI Symbol;Acc:MGI:1923620]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7419 Missense Mutation detected in F1 DNA During 2016
sa7305 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38305 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32812 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa7419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114770 Missense 313 727 7 14
Genomic Location:
Chromosome 1 (position 60285732)
KASP Assay ID:
554-4297.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTCCTGACCTTCCTCCCACACAATCCCCTCACAGCCAATCAGCTGCTC[G/C]ATCAGGTACATGCAGCYGGAGCCTGGAGAGTGTTTACTGCGGTATAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114770 Essential Splice Site 315 727 8 14
Genomic Location:
Chromosome 1 (position 60285715)
KASP Assay ID:
554-4296.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACACAATCCCCTCACAGCCAATCAGCTGCTCRATCAGGTACATGCAGC[C/T]GGAGCCTGGAGAGTGTTTACTGCGGTATAACAACACCGGCAGACTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114770 Essential Splice Site 329 727 9 14
Genomic Location:
Chromosome 1 (position 60285509)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTCAGGTGT[C/T]CGCTGTGGCTCTGCTCTATCAGTCTGGCTGTGGCTCGTCTGCTCCGCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32812
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114770 Nonsense 647 727 14 14
Genomic Location:
Chromosome 1 (position 60281156)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCGGAGCTCCGGGCGCTGCAGCAGGAAGTGTTCTCTCTGCACCGGGTT[C/T]GAGAGCGTGTGTCCCAGCAGCTGGATGTGCTGTGGCGGGAGAACCGGCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link