Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
LOC100333462
- Ensembl ID:
- ENSDARG00000076937
- Human Orthologue:
- C14orf28
- Human Description:
- chromosome 14 open reading frame 28 [Source:HGNC Symbol;Acc:19834]
- Mouse Orthologue:
- Gm527
- Mouse Description:
- predicted gene 527 Gene [Source:MGI Symbol;Acc:MGI:2685373]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa44406 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa44406
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000111290 | Nonsense | 48 | 307 | 1 | 6 |
- Genomic Location (Zv9):
- Chromosome Zv9_NA429 (position 4276)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 576961 GRCz11 17 584323 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCTTCAGCATCCGGGCGGGCCGCAGAGCCATCGCCAGCACACCCCTGTA[T/A]GTGGAGATCAGCCTGAAGAACACCTGCACCATCGACGGCTTCCTCATGCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
