aldh1a3

Ensembl ID:
ENSDARG00000076933
ZFIN ID:
ZDB-GENE-061128-2
Description:
aldehyde dehydrogenase family 1 member A3 [Source:RefSeq peptide;Acc:NP_001038210]
Human Orthologue:
ALDH1A3
Human Description:
aldehyde dehydrogenase 1 family, member A3 [Source:HGNC Symbol;Acc:409]
Mouse Orthologue:
Aldh1a3
Mouse Description:
aldehyde dehydrogenase family 1, subfamily A3 Gene [Source:MGI Symbol;Acc:MGI:1861722]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa118 Nonsense Available for shipment Available now
sa34007 Nonsense Mutation detected in F1 DNA During 2016
sa15721 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa118
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055593 Nonsense 88 513 3 13
Genomic Location:
Chromosome 7 (position 10619890)
KASP Assay ID:
554-0872.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGAGGCGGTGAAAGCTGCTAAAGCTGCGGGTCAGAGAGGCTCGGTGTG[G/A]CGGAGGATGGACGCGTCGAGCCGCGGAAGGTTATTRAACAGACTCGCCGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa34007
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055593 Nonsense 339 513 9 13
Genomic Location:
Chromosome 7 (position 10555587)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAAGAGCCCGTTTATGAGGAGTTTGTGCGTCTCAGTGTGGAAAGAGCC[A/T]AGAATATAGTGATCGGAGACCCAATGGAGCCACGCACATCACACGGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15721
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055593 Nonsense 464 513 12 13
Genomic Location:
Chromosome 7 (position 10546264)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTGTTGTCCATCTGAAGTCCATCGCTCATGTTTGTTTGTTCTKCAG[G/A]GTGAACTGCTACAACGCATTACATGCTCAAACTCCATTYGGAGGATACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link