aldh1a3

Ensembl ID:
ENSDARG00000076933
ZFIN ID:
ZDB-GENE-061128-2
Description:
aldehyde dehydrogenase family 1 member A3 [Source:RefSeq peptide;Acc:NP_001038210]
Human Orthologue:
ALDH1A3
Human Description:
aldehyde dehydrogenase 1 family, member A3 [Source:HGNC Symbol;Acc:409]
Mouse Orthologue:
Aldh1a3
Mouse Description:
aldehyde dehydrogenase family 1, subfamily A3 Gene [Source:MGI Symbol;Acc:MGI:1861722]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa118 Nonsense Available for shipment Available now
sa15721 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa118
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055593 Nonsense 88 513 3 13
Genomic Location:
Chromosome 7 (position 10619890)
KASP Assay ID:
554-0872.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGAGGCGGTGAAAGCTGCTAAAGCTGCGGGTCAGAGAGGCTCGGTGTG[G/A]CGGAGGATGGACGCGTCGAGCCGCGGAAGGTTATTRAACAGACTCGCCGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa15721
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055593 Nonsense 464 513 12 13
Genomic Location:
Chromosome 7 (position 10546264)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTGTTGTCCATCTGAAGTCCATCGCTCATGTTTGTTTGTTCTKCAG[G/A]GTGAACTGCTACAACGCATTACATGCTCAAACTCCATTYGGAGGATACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/64r1mdbc