NP_001128580.1

Ensembl ID:
ENSDARG00000076931
Description:
calpain-7 [Source:RefSeq peptide;Acc:NP_001128580]
Human Orthologue:
CAPN7
Human Description:
calpain 7 [Source:HGNC Symbol;Acc:1484]
Mouse Orthologue:
Capn7
Mouse Description:
calpain 7 Gene [Source:MGI Symbol;Acc:MGI:1338030]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31119 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44395 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31119
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043112 Essential Splice Site 123 815 3 21
ENSDART00000043112 Essential Splice Site 123 815 3 21
Genomic Location (Zv9):
Chromosome Zv9_scaffold3563 (position 166531)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36183892
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGCCATTGAGCTCTACACTCAGGCTGTAGAGTTGTGCATTCAAGCGG[T/C]GAGGCCTCAAATATGGAGAAATGATTCCAATCAGATGTCAGTATATTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44395
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043112 Essential Splice Site 123 815 3 21
ENSDART00000043112 Essential Splice Site 123 815 3 21
Genomic Location (Zv9):
Chromosome Zv9_scaffold3563 (position 166531)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36183892
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGCCATTGAGCTCTACACTCAGGCTGTAGAGTTGTGCATTCAAGCGG[T/C]GAGGCCTCAAATATGGAGAAATGATTCCAATCAGATGTCAGTATATTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link