si:ch211-216c6.1

Ensembl ID:
ENSDARG00000076928
ZFIN ID:
ZDB-GENE-090312-98
Mouse Orthologue:
Tet2
Mouse Description:
tet oncogene family member 2 Gene [Source:MGI Symbol;Acc:MGI:2443298]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11184 Nonsense Available for shipment Available now
sa14623 Nonsense Available for shipment Available now
sa8671 Nonsense Mutation detected in F1 DNA During 2017
sa32686 Nonsense Mutation detected in F1 DNA During 2017
sa13278 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11184
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113020 Nonsense 355 1715 1 9
ENSDART00000143170   None 414 None 8
Genomic Location (Zv9):
Chromosome 1 (position 25257936)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25681634
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACTGATGAAAACCTCCATGGCAATAGAGACTTTTCCTTGCTTCAGCAA[C/T]AGACTCATGAGCCACAAGCAGTAGAGAGCAAGTTGATTCCCCAGGCWTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14623
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113020 Nonsense 654 1715 1 9
ENSDART00000143170   None 414 None 8
Genomic Location (Zv9):
Chromosome 1 (position 25258833)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25682531
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAACTCCAGCAGAACACAGAGTGCTCACAGRACATTAGTACAGGACAA[C/T]AAATCTACCAGCAACCTCTCCAACATAGGATATACAATCATTCAGAATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8671
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113020 Nonsense 708 1715 1 9
ENSDART00000143170   None 414 None 8
Genomic Location (Zv9):
Chromosome 1 (position 25258995)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25682693
KASP Assay ID:
2259-0625.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCGGACATTGACCAAAGCTGAATTCCATGAGTCCTTTGCCCAAATCCAG[A/T]GAGAGTCTCTCTCAAGCARTGGTGCTCAAATGGATGTTCAGAGGCATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32686
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113020 Nonsense 973 1715 4 9
ENSDART00000143170 Nonsense 150 414 4 8
Genomic Location (Zv9):
Chromosome 1 (position 25260121)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25683819
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATTTTATACATATTTTGTAGGTAATACGGAGAGCAAATGAAGACGAG[A/T]AAATCCTGGTCTTGGTACGAGAGAGGGCTGGTCACTCGTGCGAGACATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13278
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113020 Nonsense 1573 1715 9 9
ENSDART00000143170   None 414 None 8
Genomic Location (Zv9):
Chromosome 1 (position 25266230)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25689928
KASP Assay ID:
2259-0626.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAAGATGTGTGGKCTGATAGTGAGCACAACTTCCTTGATCCTGAAATT[G/T]GAGGAGTGGCAGTGGCACCTAGTCATGGGTCTATTATTATTGAGTGTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link