ENSDARG00000076924

Ensembl ID:
ENSDARG00000076924
Mouse Orthologue:
Als2
Mouse Description:
amyotrophic lateral sclerosis 2 (juvenile) homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1921268]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15114 Nonsense Available for shipment Available now
sa8220 Nonsense Mutation detected in F1 DNA During 2014
sa15705 Essential Splice Site Available for shipment Available now
sa5351 Nonsense Mutation detected in F1 DNA During 2014
sa12310 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15114
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108524 Nonsense 87 1658 3 37
Genomic Location:
Chromosome 6 (position 7927698)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAACCAAAYATCATCAGCAGAGCCCATTTTGGAGGCAGTGCTGAGCGAA[C/T]AGCGTGTTGTTTTTGTGGCTGCTGGCTCCGCSCACAGCGGAGTYGTGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8220
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108524 Nonsense 433 1658 7 37
Genomic Location:
Chromosome 6 (position 7923654)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCCTACTTGCCACTTSAAACTAACCWATTGTGATCCATCATCCAGYTA[T/A]GACATGTTTGTGCTCCAGGTTCCAGGAGAGGGTCGCGAGCGAGTGGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15705
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108524 Essential Splice Site 604 1658 11 37
Genomic Location:
Chromosome 6 (position 7908884)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGATTCCTGACTGTTTTGCTTTTTGTWTSTCCTCTTTTGTCTTTGCGC[A/T]GCTGTCAGATGGGATTCRTGTGTGGGATATTGGGGCAGGTCWGCAGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5351
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108524 Nonsense 1274 1658 26 37
Genomic Location:
Chromosome 6 (position 7882447)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCGGGCTAAAGATGKCAGGTTCCTACTACAAACCCAGCCTGTACGACT[C/A]AGACAAGGAGAAGGGTCATGCACTGTAAGAGCATTGTTGATCTGTGWRGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12310
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108524 Essential Splice Site 1467 1658 31 37
Genomic Location:
Chromosome 6 (position 7879804)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGRTCGGCACAGAYGCTGATGGAAAGCTGCTGGAGTCTCCTAAACCTGGG[T/A]ATGGAAAATAGTATTAAAGGACTCTAAGGGTGGTCTATGCAACWGCAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u79cyhvu