si:dkey-159f12.3

Ensembl ID:
ENSDARG00000076923
ZFIN ID:
ZDB-GENE-081105-97
Description:
Kazrin-A [Source:UniProtKB/Swiss-Prot;Acc:A9C3W3]
Human Orthologue:
RP1-21O18.1
Human Description:
Kazrin [Source:UniProtKB/Swiss-Prot;Acc:Q674X7]
Mouse Orthologue:
9030409G11Rik
Mouse Description:
RIKEN cDNA 9030409G11 gene Gene [Source:MGI Symbol;Acc:MGI:1918779]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16379 Nonsense Available for shipment Available now
sa21311 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16379
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110432 Nonsense 58 814 1 16
ENSDART00000139787 Nonsense 58 786 1 15

The following transcripts of ENSDARG00000076923 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 27645400)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26773318
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGAGCTGGAAGAACCGGGAGAACCGCAGGAACATCAGCAGCAGCAGCAA[C/T]AACAGAACCACCAGGGTAAGAAKCTGCACCTGTGACCGCTTATGTCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21311
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110432 Essential Splice Site 515 814 None 16
ENSDART00000139787 Essential Splice Site 487 786 None 15

The following transcripts of ENSDARG00000076923 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 27575855)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26703773
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGCCGATGTACATGCGCGCCTGTGCCGACAACGTCAAAAGCGGGAAGG[T/G]AAATGACAACCTGTCATTTTATTACTTAAACAGTTGTCTACGTCATTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link