igdcc4

Ensembl ID:
ENSDARG00000076919
ZFIN ID:
ZDB-GENE-080327-32
Human Orthologue:
IGDCC4
Human Description:
immunoglobulin superfamily, DCC subclass, member 4 [Source:HGNC Symbol;Acc:13770]
Mouse Orthologue:
Igdcc4
Mouse Description:
immunoglobulin superfamily, DCC subclass, member 4 Gene [Source:MGI Symbol;Acc:MGI:1858497]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15443 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15443
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113467 Nonsense 484 1246 8 20
Genomic Location:
Chromosome 7 (position 32992132)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAYGACACCACAGAGCTGCATGTGAAAGAACTGCTCCCTCACACAGCCTA[C/A]AYGTTCTATGTAGTRGCCTATTCGCCCATGGGTGCCAGTCGCCCGTCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p4nvfavw