igdcc4

Ensembl ID:
ENSDARG00000076919
ZFIN ID:
ZDB-GENE-080327-32
Human Orthologue:
IGDCC4
Human Description:
immunoglobulin superfamily, DCC subclass, member 4 [Source:HGNC Symbol;Acc:13770]
Mouse Orthologue:
Igdcc4
Mouse Description:
immunoglobulin superfamily, DCC subclass, member 4 Gene [Source:MGI Symbol;Acc:MGI:1858497]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38621 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34101 Nonsense Mutation detected in F1 DNA During 2016
sa15443 Nonsense Available for shipment Available now
sa40929 Nonsense Mutation detected in F1 DNA During 2016
sa38620 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38621
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113467 Essential Splice Site 224 1246 5 20
Genomic Location (Zv9):
Chromosome 7 (position 33004479)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACACACACACACACACACACACACGCACTCATGATATGTCTGTGTGTA[G/T]GTCTGTCTCAGGAGAGTGAGGTGGTGATTGTGGCTCCGCCACAGAACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34101
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113467 Nonsense 462 1246 8 20
Genomic Location (Zv9):
Chromosome 7 (position 32992198)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31386538
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAACGATAAATGTGCTTGTTTGTTTGCAGGCTCAGACAACATGGAGTA[T/A]CAGTTTGCGGTGAATAACGACACCACAGAGCTGCATGTGAAAGAACTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15443
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113467 Nonsense 484 1246 8 20
Genomic Location (Zv9):
Chromosome 7 (position 32992132)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31386472
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAYGACACCACAGAGCTGCATGTGAAAGAACTGCTCCCTCACACAGCCTA[C/A]AYGTTCTATGTAGTRGCCTATTCGCCCATGGGTGCCAGTCGCCCGTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40929
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113467 Nonsense 832 1246 15 20
Genomic Location (Zv9):
Chromosome 7 (position 32981500)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31375840
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGTGTTTTCCGACAGGACCCTCCTCTCCTGTGGACATGCAGT[T/A]AAGCGCTCTGGACTCGTTCTCAGTTCTGGTGAGCTGGCGCCCTCCGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38620
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113467 Nonsense 1098 1246 20 20
Genomic Location (Zv9):
Chromosome 7 (position 32963702)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31358042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGACACGTGGAGAGGTTGTATTCCCTCAGCAAGAACCAGGTGGAGGCT[G/T]AAGTCATCGTGCATTCACAGCTGTCCAACGCAACAGTTGACCAGGGGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link