eme1

Ensembl ID:
ENSDARG00000076913
ZFIN ID:
ZDB-GENE-030131-3191
Human Orthologue:
EME1
Human Description:
essential meiotic endonuclease 1 homolog 1 (S. pombe) [Source:HGNC Symbol;Acc:24965]
Mouse Orthologue:
Eme1
Mouse Description:
essential meiotic endonuclease 1 homolog 1 (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:3576783]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7359 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7359
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112726 Missense 539 556 8 8
Genomic Location:
Chromosome 12 (position 23028332)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGGGTGTGACATCTACAACCCGYAGAGTCGGTCCAGAACTTTCCAAA[C/G]GAGTCTATCTTATGATGACCTCAAGTGATGACCAACAACCCCTTGATTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0pei2vxc