si:ch211-206k20.6

Ensembl ID:
ENSDARG00000076903
ZFIN ID:
ZDB-GENE-090312-181
Description:
BEN domain-containing protein 3 [Source:RefSeq peptide;Acc:NP_001139063]
Human Orthologue:
BEND3
Human Description:
BEN domain containing 3 [Source:HGNC Symbol;Acc:23040]
Mouse Orthologue:
Bend3
Mouse Description:
BEN domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2677212]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44792 Nonsense Mutation detected in F1 DNA During 2017
sa6315 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44792
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112292 Nonsense 627 816 3 3
ENSDART00000132820 Nonsense 627 816 4 4
ENSDART00000138571   None 89 None 3
Genomic Location (Zv9):
Chromosome 13 (position 32867273)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTGTCGGCAAACTTGATGAACGATGTAGACGACGAGATACCGACCAA[C/T]GACGTTCATATCAACAACAGCGGAAAGCCTGTTCACCTGATCAAGAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6315
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112292 Nonsense 635 816 3 3
ENSDART00000132820 Nonsense 635 816 4 4
ENSDART00000138571   None 89 None 3
Genomic Location (Zv9):
Chromosome 13 (position 32867249)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 32513197
KASP Assay ID:
554-5003.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GMTGTAGACGACGAGATACYGACCAACGACGTTCATATCAACAACAGCGG[A/T]AAGCCTGTTCACCTGATCAAGAGCCTGACCCGAATGACTCCCTGTTATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link