si:dkey-188g12.1

Ensembl ID:
ENSDARG00000076896
ZFIN ID:
ZDB-GENE-070705-332
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0R0E4]
Human Orthologue:
C10orf67
Human Description:
chromosome 10 open reading frame 67 [Source:HGNC Symbol;Acc:28716]
Mouse Orthologue:
4921504E06Rik
Mouse Description:
RIKEN cDNA 4921504E06 gene Gene [Source:MGI Symbol;Acc:MGI:1918087]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19783 Nonsense Available for shipment Available now
sa32935 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19783
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110595 Nonsense 22 431 1 14
ENSDART00000142057 Nonsense 51 300 1 8
Genomic Location (Zv9):
Chromosome 2 (position 29476648)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 29778283
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGAGGATAAACAGCATTGCGGATGAAGCCGAGGATGCGCTGATTTCA[C/T]AAGAGATTGAGGAAATACATCGGTAAGACGTTTTGTTGTTGTTGCTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32935
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110595 Essential Splice Site 340 431 12 14
ENSDART00000142057   None 300 None 8
Genomic Location (Zv9):
Chromosome 2 (position 29447742)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 29749377
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTACATGTGTGTTTCACTTCTTCATTCTAATTGTTTCTTTATTTTATC[A/G]GGCTCAATAAGCAGTTGTGCATGTCCAATCAGGTGTGGGAGAAGAAATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link