flrt3

Ensembl ID:
ENSDARG00000076895
ZFIN ID:
ZDB-GENE-030131-1988
Description:
Novel protein (Wu:fb93g11) [Source:UniProtKB/TrEMBL;Acc:B8A507]
Human Orthologue:
FLRT3
Human Description:
fibronectin leucine rich transmembrane protein 3 [Source:HGNC Symbol;Acc:3762]
Mouse Orthologue:
Flrt3
Mouse Description:
fibronectin leucine rich transmembrane protein 3 Gene [Source:MGI Symbol;Acc:MGI:1918686]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa219 Nonsense Confirmed mutation in F2 line During 2014
sa2686 Nonsense F2 line generated During 2014
sa251 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa219
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112985 Nonsense 107 649 1 1
ENSDART00000143703 Nonsense 107 649 3 3
Genomic Location:
Chromosome 13 (position 34043781)
KASP Assay ID:
554-0157.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATACTGCAACAACCTGGATGAGTTCCCCACCAATTTGCCGCTTAATGTC[A/T]AGGAACTTCATTTACAGGAGAACAATATCCGGACTATCACACACGCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2686
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112985 Nonsense 224 649 1 1
ENSDART00000143703 Nonsense 224 649 3 3
ENSDART00000112985 Nonsense 224 649 1 1
ENSDART00000143703 Nonsense 224 649 3 3
Genomic Location:
Chromosome 13 (position 34043429)
KASP Assay ID:
554-2629.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCAACCTCCTGAACAACAGGGGCATCGGGGAGATGGCCTTGGTGAATT[T/A]AGTAAATCTGACCGAGCTCTCATTGGTACGAAACTCCCTGACGTCCCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa251
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112985 Nonsense 224 649 1 1
ENSDART00000143703 Nonsense 224 649 3 3
ENSDART00000112985 Nonsense 224 649 1 1
ENSDART00000143703 Nonsense 224 649 3 3
Genomic Location:
Chromosome 13 (position 34043429)
KASP Assay ID:
554-2629.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCAACCTCCTGAACAACAGGGGCATCGGGGAGATGGCCTTGGTGAATT[T/A]AGTAAATCTGACCGAGCTCTCATTGGTACGAAACTCCCTGACGTCCCCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jci4a0nh