ralgapa1

Ensembl ID:
ENSDARG00000076889
ZFIN IDs:
ZDB-GENE-080806-1, ZDB-GENE-080806-1
Description:
ral GTPase-activating protein subunit alpha-1 [Source:RefSeq peptide;Acc:NP_001139776]
Human Orthologue:
RALGAPA1
Human Description:
Ral GTPase activating protein, alpha subunit 1 (catalytic) [Source:HGNC Symbol;Acc:17770]
Mouse Orthologue:
Ralgapa1
Mouse Description:
Ral GTPase activating protein, alpha subunit 1 Gene [Source:MGI Symbol;Acc:MGI:1931050]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15658 Nonsense Available for shipment Available now
sa14320 Essential Splice Site Available for shipment Available now
sa9808 Essential Splice Site Available for shipment Available now
sa23016 Nonsense Available for shipment Available now
sa15393 Nonsense Available for shipment Available now
sa11505 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15658
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112469 Nonsense 71 2105 2 40
ENSDART00000124584 Nonsense 71 2066 2 40
Genomic Location:
Chromosome 17 (position 12649174)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTACTATGTCTTCTTTGAAAACTTYGTCACCATCGAGGTTAACCTGAAA[C/T]AGAAAGGTAAGACCTGGAGCACTTCATWTTCTTTGTTGTTTAAAGATAWA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14320
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112469 Essential Splice Site 838 2105 19 40
ENSDART00000124584 Essential Splice Site 838 2066 19 40
Genomic Location:
Chromosome 17 (position 12690980)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YTTCTATGTGAKAGCGTTYATATAGTTGATGACTTTGTSGTGTTGTTTTT[A/G]GGGCATGACGAGGCGCGGCAGTAGCCCAGGAAGTCTGGAGATCCCTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9808
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112469 Essential Splice Site 909 2105 19 40
ENSDART00000124584 Essential Splice Site 909 2066 19 40
Genomic Location:
Chromosome 17 (position 12691197)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCAATCGGATTCCTTWAACGCTTTTCAATATGACAGCAAATTCGAAAG[T/A]AAGTGGAGTATTCAGTTAAAGGGAAAAGTCAWGTGATGTGCTTGATTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23016
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112469 Nonsense 919 2105 20 40
ENSDART00000124584 Nonsense 919 2066 20 40
Genomic Location:
Chromosome 17 (position 12691377)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAAAATGTTTGTGTGCAGATTTCAGCTTCCCCCCTGAGACGTGTGCTT[T/A]GGCGTCTGCAGATCAGGATAGTTTGAGTGGGACAGGACAGACAGCGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15393
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112469 Nonsense 2017 2105 39 40
ENSDART00000124584 Nonsense 2017 2066 39 40
Genomic Location:
Chromosome 17 (position 12774286)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAATCGATGCWCCRTGTTTGTTTGACTTTAACTCGCATCTGTCAGCTA[T/A]GAAKARAGGGCCAGATATCTGGAGACGATAGTCCARCATCACTTGGAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11505
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112469 Nonsense 2019 2105 39 40
ENSDART00000124584 Nonsense 2019 2066 39 40
Genomic Location:
Chromosome 17 (position 12774290)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGATGCWCCATGTTTGTTTGACTTTAACTCGCATCTGTCAGCTATGAA[G/T]ARAGGGCCAGATATCTGGAGACGATAGTCCARCATCACTTGGAGCCCACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/iuwjkh14