LOC799850

Ensembl ID:
ENSDARG00000076873
Human Orthologue:
C9orf172
Human Description:
chromosome 9 open reading frame 172 [Source:HGNC Symbol;Acc:37284]
Mouse Orthologue:
Gm996
Mouse Description:
predicted gene 996 Gene [Source:MGI Symbol;Acc:MGI:2685842]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15525 Nonsense Available for shipment Available now
sa655 Nonsense F2 line generated During 2014
hu7912 Missense Available for shipment Available now
sa12549 Nonsense Available for shipment Available now
sa12539 Nonsense Available for shipment Available now
sa18924 Nonsense Mutation detected in F1 DNA During 2014
sa25399 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15525
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112170 Nonsense 39 1057 1 2
Genomic Location:
Chromosome 8 (position 32097123)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAACTCWGGGCTCTCAAAGTATTCTGGATCTTCGAAGCAAWGTGATTCA[C/T]AAATGGTWGGCCCACTGGATCAAAACTTCGAAACAATTAACAAAAGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa655
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112170 Nonsense 287 1057 1 2
Genomic Location:
Chromosome 8 (position 32097869)
KASP Assay ID:
554-0563.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAACACCAACCCCTAGTGAGTGTTACAACATGGACTACAGGCAAGCATA[T/A]CAGTATCCCAACAGCTTGTCAAGTAGTTACATTCATTCTGGTGAGATCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu7912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112170 Missense 305 1057 1 2
Genomic Location:
Chromosome 8 (position 32097923)
KASP Assay ID:
554-2397.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCCCAACAGCTTGTCAAGTAGTTACATTCATTCTGGTGAGATCCCTTT[T/A]GGAAGGACCTCTCCTAGAGATCCAAGGGAGTACAGAACATTGTCTAATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12549
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112170 Nonsense 428 1057 1 2
ENSDART00000112170 Nonsense 428 1057 1 2
ENSDART00000112170 Nonsense 428 1057 1 2
Genomic Location:
Chromosome 8 (position 32098290)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCCACCCCTCAGAGTGAAACATACTTTCAGGATGACCCAAGAACATAT[G/T]GATTTCCCWCTGATCCATCAAAAATGTTCTATACAMGGYCTTGCCATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12539
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112170 Nonsense 428 1057 1 2
ENSDART00000112170 Nonsense 428 1057 1 2
ENSDART00000112170 Nonsense 428 1057 1 2
Genomic Location:
Chromosome 8 (position 32098290)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCCACCCCTCAGAGTGAAACATACTTTCAGGATGACCCAAGAACATAT[G/T]GATTTCCCWCTGATCCATCAAAAATGTTCTATACAMGGYCTTGCCATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18924
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112170 Nonsense 428 1057 1 2
ENSDART00000112170 Nonsense 428 1057 1 2
ENSDART00000112170 Nonsense 428 1057 1 2
Genomic Location:
Chromosome 8 (position 32098290)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCCACCCCTCAGAGTGAAACATACTTTCAGGATGACCCAAGAACATAT[G/T]GATTTCCCTCTGATCCATCAAAAATGTTCTATACACGGCCTTGCCATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112170 Nonsense 1044 1057 1 2
Genomic Location:
Chromosome 8 (position 32100140)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCACCACCATTTATCCCATTGACAAGAGAACTGGGAAACAGTTCATGTG[T/A]ATGATCATGGCAGCGTCTGAACCAAGGATGCTAGATTGGGTTGGTGCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6kfpvkla