im:7149048

Ensembl ID:
ENSDARG00000076870
ZFIN ID:
ZDB-GENE-041111-255
Human Orthologue:
FAM38A
Human Description:
family with sequence similarity 38, member A [Source:HGNC Symbol;Acc:28993]
Mouse Orthologue:
Fam38a
Mouse Description:
family with sequence similarity 38, member A Gene [Source:MGI Symbol;Acc:MGI:3603204]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12608 Essential Splice Site Available for shipment Available now
sa17785 Essential Splice Site Available for shipment Available now
sa10147 Essential Splice Site Available for shipment Available now
sa7089 Nonsense Mutation detected in F1 DNA During 2014
sa2346 Nonsense F2 line generated During 2014
sa21090 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108646 Essential Splice Site 390 2538 9 51
Genomic Location:
Chromosome 7 (position 56657533)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCAGATTGTGGGAGGCAAGGAGACAAAGCAGTGAAGAYGACACTAAG[G/A]TAAAGAATAAAACTTGACATTTTACATTTAYATATTATGGAACCTTAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17785
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108646 Essential Splice Site 1065 2538 22 51
Genomic Location:
Chromosome 7 (position 56631928)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATAYCAGTATGTTCTGTGTGTGGGGATTCCTCCTGCCCTCTGTAYAGG[T/A]AAGTCAAACACTATAATYAATRMACTAGTTGTTGTTGTTGACATTATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10147
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108646 Essential Splice Site 1152 2538 24 51
Genomic Location:
Chromosome 7 (position 56630207)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATGGAGAACATGCTTTTCAAWCCTGCCCCAAACTTCATCAACTGCAGG[T/A]ACGTACATCACRGTATTTGTACATGATGTAAGTTTCATTATCCCCACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7089
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108646 Nonsense 1439 2538 32 51
Genomic Location:
Chromosome 7 (position 56619521)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGAAGTGTGWAAAGCTTTTNATTTTGAACTGATTTCCACAGCTGGCATA[T/A]CAGGCTTGGGTCACCAGTGCAAAAGATGCCCTGAAAGAGCGTCAGCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2346
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108646 Nonsense 2043 2538 42 51
Genomic Location:
Chromosome 7 (position 56604050)
KASP Assay ID:
554-2478.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTYAGCACCATGATCATCGATCGAGCATTATACCTGCGGAAGAGCATCT[T/A]GGGAAAGCTCATCTTCCAGGTTATCCTGGTTTTTGGCATCCACCTTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21090
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108646 Nonsense 2134 2538 44 51
Genomic Location:
Chromosome 7 (position 56603601)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTGTGTTTCTCCATAGATTCCGTCTGGTTCCATTTTTAGTGGAGCTT[C/T]GAGCTGTGATGGACTGGGTTTGGACAGACACCACACTCTCTCTCTCTAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qcqx7qvo