im:7149048

Ensembl ID:
ENSDARG00000076870
ZFIN ID:
ZDB-GENE-041111-255
Human Orthologue:
FAM38A
Human Description:
family with sequence similarity 38, member A [Source:HGNC Symbol;Acc:28993]
Mouse Orthologue:
Fam38a
Mouse Description:
family with sequence similarity 38, member A Gene [Source:MGI Symbol;Acc:MGI:3603204]

Alleles

There are 13 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30895 Nonsense Mutation detected in F1 DNA During 2016
sa30894 Essential Splice Site Mutation detected in F1 DNA During 2016
sa12608 Essential Splice Site Available for shipment Available now
sa34199 Nonsense Mutation detected in F1 DNA During 2016
sa27065 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17785 Essential Splice Site Available for shipment Available now
sa10147 Essential Splice Site Available for shipment Available now
sa34198 Nonsense Mutation detected in F1 DNA During 2016
sa7089 Nonsense Mutation detected in F1 DNA During 2016
sa34197 Nonsense Mutation detected in F1 DNA During 2016
sa34196 Essential Splice Site Mutation detected in F1 DNA During 2016
sa2346 Nonsense F2 line generated During 2016
sa21090 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa30895
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108646 Nonsense 78 2538 3 51
Genomic Location (Zv9):
Chromosome 7 (position 56692231)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55127557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCACTCTTCAGCACCAGTCTGATTTTTATCTTGGGACACGTTACCTTT[C/T]AGATCTGCCTGTATACCATCCCAAGCCTTGATGACGCACTGGGACACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108646 Essential Splice Site 160 2538 5 51
Genomic Location (Zv9):
Chromosome 7 (position 56684238)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55119564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAGAGACGAGGGCTCCGTTCCTCACATGTCTGCTCTTCTGCATGAGG[T/C]GAGCTGAACTGAACTTTGGGAATTTGTTGAGTAATGCTGTTAGTCTGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108646 Essential Splice Site 390 2538 9 51
Genomic Location (Zv9):
Chromosome 7 (position 56657533)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55092859
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCAGATTGTGGGAGGCAAGGAGACAAAGCAGTGAAGAYGACACTAAG[G/A]TAAAGAATAAAACTTGACATTTTACATTTAYATATTATGGAACCTTAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34199
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108646 Nonsense 568 2538 13 51
Genomic Location (Zv9):
Chromosome 7 (position 56649904)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55085230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTCAGTGAAGGACACATTCAGCAGGAAGAAGAGTTTGACTGTGCCAT[T/A]GCAGGAGGTCACAACTGGAGGTGAGCGAGAACACTGGGGGCTCTATTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27065
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108646 Essential Splice Site 774 2538 17 51
Genomic Location (Zv9):
Chromosome 7 (position 56641555)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55076881
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAAGAGCTGATCGTGGATCAGGATGATTATCCATCAGAGGCTGACGG[T/A]GAGAGTAATGAAGGCTGCTTCTGTGCCATTGTTGTTCAATCAAAACAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17785
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108646 Essential Splice Site 1065 2538 22 51
Genomic Location (Zv9):
Chromosome 7 (position 56631928)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55067254
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATAYCAGTATGTTCTGTGTGTGGGGATTCCTCCTGCCCTCTGTAYAGG[T/A]AAGTCAAACACTATAATYAATRMACTAGTTGTTGTTGTTGACATTATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10147
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108646 Essential Splice Site 1152 2538 24 51
Genomic Location (Zv9):
Chromosome 7 (position 56630207)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55065533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATGGAGAACATGCTTTTCAAWCCTGCCCCAAACTTCATCAACTGCAGG[T/A]ACGTACATCACRGTATTTGTACATGATGTAAGTTTCATTATCCCCACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34198
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108646 Nonsense 1410 2538 31 51
Genomic Location (Zv9):
Chromosome 7 (position 56619705)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55055031
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAATATAAATCTATGTTGTCGTTTTAGTGTTGCATTCTGGGGAATACTA[T/A]ATGTTTGAGTCTGACAGTGGAGAGGAGGATGAAACCTTTCAGGAAGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7089
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108646 Nonsense 1439 2538 32 51
Genomic Location (Zv9):
Chromosome 7 (position 56619521)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55054847
KASP Assay ID:
554-4890.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGAAGTGTGWAAAGCTTTTNATTTTGAACTGATTTCCACAGCTGGCATA[T/A]CAGGCTTGGGTCACCAGTGCAAAAGATGCCCTGAAAGAGCGTCAGCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34197
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108646 Nonsense 1543 2538 34 51
Genomic Location (Zv9):
Chromosome 7 (position 56615998)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55051324
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCATGGTGGACGGATTCACCATGTGGCTCAACCTTCTCACCAAGCAGTA[T/A]GTTGACACCTCAATGGTCCTTAGTGAGGAGCGTTACCTGTTTATTCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108646 Essential Splice Site 1803 2538 38 51
Genomic Location (Zv9):
Chromosome 7 (position 56607857)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55043183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATCTGCTTCAACTGCTGGTGCTCTTCTTTCACCGCTCACTTCTCCAGG[T/A]AGTAAAAAAAAACAAAAAACAAAAAAACAAACCTAGACTAACATAGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2346
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108646 Nonsense 2043 2538 42 51
Genomic Location (Zv9):
Chromosome 7 (position 56604050)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55039376
KASP Assay ID:
554-2478.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTYAGCACCATGATCATCGATCGAGCATTATACCTGCGGAAGAGCATCT[T/A]GGGAAAGCTCATCTTCCAGGTTATCCTGGTTTTTGGCATCCACCTTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21090
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108646 Nonsense 2134 2538 44 51
Genomic Location (Zv9):
Chromosome 7 (position 56603601)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55038927
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTGTGTTTCTCCATAGATTCCGTCTGGTTCCATTTTTAGTGGAGCTT[C/T]GAGCTGTGATGGACTGGGTTTGGACAGACACCACACTCTCTCTCTCTAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link