im:7147988

Ensembl ID:
ENSDARG00000076868
ZFIN ID:
ZDB-GENE-050506-146
Human Orthologue:
STARD13
Human Description:
StAR-related lipid transfer (START) domain containing 13 [Source:HGNC Symbol;Acc:19164]
Mouse Orthologue:
Stard13
Mouse Description:
StAR-related lipid transfer (START) domain containing 13 Gene [Source:MGI Symbol;Acc:MGI:2385331]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10794 Essential Splice Site Available for shipment Available now
sa17556 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10794
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114382 Essential Splice Site 1198 1487 12 17
Genomic Location:
Chromosome 15 (position 32401212)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTCACTTTTTCATCTCAACATCCTGAAGAARGACAATCTTACGCCAAG[G/A]TAGAAAACACTTCTTTTGATWGTCTGTGATGTSTAAAGTTATGTTCAWCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17556
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114382 Nonsense 1257 1487 14 17
Genomic Location:
Chromosome 15 (position 32402059)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAYGAAATGGTGACACAGTCGCGTAATTCGTACGYGGAGGCCGARCTT[C/T]AGRCTCCCACCATTGAGGAGCTSTGCAAGCGGCAGCATCCRGAAGATGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2krzrcpd