im:7147988

Ensembl ID:
ENSDARG00000076868
ZFIN ID:
ZDB-GENE-050506-146
Human Orthologue:
STARD13
Human Description:
StAR-related lipid transfer (START) domain containing 13 [Source:HGNC Symbol;Acc:19164]
Mouse Orthologue:
Stard13
Mouse Description:
StAR-related lipid transfer (START) domain containing 13 Gene [Source:MGI Symbol;Acc:MGI:2385331]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35944 Nonsense Mutation detected in F1 DNA During 2016
sa35945 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35946 Nonsense Mutation detected in F1 DNA During 2016
sa10794 Essential Splice Site Available for shipment Available now
sa17556 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35944
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114382 Nonsense 114 1487 1 17
Genomic Location (Zv9):
Chromosome 15 (position 32247834)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33768713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATGCATCAAAAGTGCTTCAGATTCAATTTCAAGTCCAAACCCCAAGT[T/A]GAACGGAATTAATCATGAATCTCACATGAAAAGCCATTTTTTGACTCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35945
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114382 Essential Splice Site 408 1487 3 17
Genomic Location (Zv9):
Chromosome 15 (position 32266462)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33750085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCAGGAGCCACTTCCTCTATGGGGAGATCACATGCTAGAAAGACAGAG[G/T]TGAGCATTTCCGCTTTGAAGAATTTGAAGGAATTGTTCTCTCTATAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35946
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114382 Nonsense 460 1487 6 17
Genomic Location (Zv9):
Chromosome 15 (position 32392459)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33624088
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCAATTTCCCATTGACATCTCTCCTGTGAAGAAAGACCATGACTTCT[T/A]GGACAAAGACCTTGTGGAACCTCTATGCCGGTAAGAACTGTGTTGTATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10794
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114382 Essential Splice Site 1198 1487 12 17
Genomic Location (Zv9):
Chromosome 15 (position 32401212)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33615335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTCACTTTTTCATCTCAACATCCTGAAGAARGACAATCTTACGCCAAG[G/A]TAGAAAACACTTCTTTTGATWGTCTGTGATGTSTAAAGTTATGTTCAWCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17556
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114382 Nonsense 1257 1487 14 17
Genomic Location (Zv9):
Chromosome 15 (position 32402059)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33614488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAYGAAATGGTGACACAGTCGCGTAATTCGTACGYGGAGGCCGARCTT[C/T]AGRCTCCCACCATTGAGGAGCTSTGCAAGCGGCAGCATCCRGAAGATGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link