A8WGD0_DANRE

Ensembl ID:
ENSDARG00000076861
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A8WGD0]
Human Orthologue:
TMEM79
Human Description:
transmembrane protein 79 [Source:HGNC Symbol;Acc:28196]
Mouse Orthologue:
Tmem79
Mouse Description:
transmembrane protein 79 Gene [Source:MGI Symbol;Acc:MGI:1919163]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22871 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22871
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109505 Nonsense 195 372 2 4
Genomic Location:
Chromosome 16 (position 32674491)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTAAACTGGGAGCTTCCATGTTCACTTCAGCTTTGATCTTCCCCTTGT[T/A]GGTGTGGGGTGGCTATGTTTTCCTGCCCTTTGATGCTCCTCTACTGGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jcmuq5gf