C8orf4 (2 of 2)

Ensembl ID:
ENSDARG00000076858
Description:
chromosome 8 open reading frame 4 [Source:HGNC Symbol;Acc:1357]
Human Orthologue:
C8orf4
Human Description:
chromosome 8 open reading frame 4 [Source:HGNC Symbol;Acc:1357]
Mouse Orthologue:
1810011O10Rik
Mouse Description:
RIKEN cDNA 1810011O10 gene Gene [Source:MGI Symbol;Acc:MGI:1916318]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11557 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11557
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111097 Nonsense 54 106 1 1
Genomic Location:
Chromosome 10 (position 20290595)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAACATTTTCGAGAACGTCAACCAGGASGTKCTGGTGAAGCTTTTCGAG[A/T]AAGCGGGAGACCTGAAGGCGGTGGAGAGAGCCAGGAGCATCCTCACACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vtu1ypjr