frem2a

Ensembl ID:
ENSDARG00000076856
ZFIN ID:
ZDB-GENE-081119-3
Description:
Fras1 related extracellular matrix protein 2a [Source:RefSeq peptide;Acc:NP_001131129]
Human Orthologue:
FREM2
Human Description:
FRAS1 related extracellular matrix protein 2 [Source:HGNC Symbol;Acc:25396]
Mouse Orthologue:
Frem2
Mouse Description:
Fras1 related extracellular matrix protein 2 Gene [Source:MGI Symbol;Acc:MGI:2444465]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16135 Nonsense Available for shipment Available now
sa17334 Essential Splice Site Available for shipment Available now
sa24874 Nonsense Mutation detected in F1 DNA During 2014
sa21742 Nonsense Mutation detected in F1 DNA During 2014
sa14672 Nonsense Available for shipment Available now
sa2557 Nonsense F2 line generated During 2014
sa5585 Nonsense F2 line generated During 2014
sa21743 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16135
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108808 Nonsense 1112 3119 1 25
ENSDART00000128292 Nonsense 1112 3113 1 25
ENSDART00000143255 None None 1427 None 23
Genomic Location:
Chromosome 10 (position 26620264)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGACAGGTTMACGTTCAGATGTTCKGAWGGTGTRAATTTCTCAGAGAGA[C/T]AGTTCTTTCCCATTGTCATTATYCCCACAAATGATGAAAAACCAGAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17334
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108808 Essential Splice Site 1748 3119 None 25
ENSDART00000128292 Essential Splice Site 1748 3113 None 25
ENSDART00000143255 Essential Splice Site 56 1427 None 23
Genomic Location:
Chromosome 10 (position 26653965)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGTGACCCTCAGACGGAGAGGTTTCCTGGGTGAAACGTCTTTTGTTGG[T/C]GAGTATCTTTATATGCAATTTAGCTTTGCCTGCATTTTCCACTCATTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24874
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108808 Nonsense 1793 3119 4 25
ENSDART00000128292 Nonsense 1793 3113 4 25
ENSDART00000143255 Nonsense 101 1427 2 23
Genomic Location:
Chromosome 10 (position 26660005)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCACAGCCTCCTGGAAAGTCAGAGTTCTCTCGGATGGGAAATACGAG[C/T]AGTCCGAAACGTTTCAAATTGTGCTGACTGAGCCGGTGATGGGCGTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21742
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108808 Nonsense 2663 3119 17 25
ENSDART00000128292 Nonsense 2663 3113 17 25
ENSDART00000143255 Nonsense 971 1427 15 23
Genomic Location:
Chromosome 10 (position 26733166)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCTTTGTTTATGACACTGCCATCTTGTGGAAGGACGGAGTCGGCAGC[C/T]AAACACAGGCTGATCTACAAGGCAAGTCATGAGTTTCAGAAACAAGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14672
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108808 Nonsense 2878 3119 23 25
ENSDART00000128292 Nonsense 2872 3113 23 25
ENSDART00000143255 Nonsense 1186 1427 21 23
ENSDART00000108808 Nonsense 2878 3119 23 25
ENSDART00000128292 Nonsense 2872 3113 23 25
ENSDART00000143255 Nonsense 1186 1427 21 23
Genomic Location:
Chromosome 10 (position 26742243)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTACTGTAACATTGAGAAGGTGTATCTGTGCACTGGAGCTGATGGATA[T/A]GTTCCTAAATACAACCCCAGCAAGTCTGAGTTTGGATGCCTTGCTGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2557
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108808 Nonsense 2878 3119 23 25
ENSDART00000128292 Nonsense 2872 3113 23 25
ENSDART00000143255 Nonsense 1186 1427 21 23
ENSDART00000108808 Nonsense 2878 3119 23 25
ENSDART00000128292 Nonsense 2872 3113 23 25
ENSDART00000143255 Nonsense 1186 1427 21 23
Genomic Location:
Chromosome 10 (position 26742243)
KASP Assay ID:
554-3067.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTACTGTAACATTGAGAAGGTGTATCTGTGCACTGGAGCTGATGGATA[T/A]GTTCCTAAATACAACCCCAGCAAGTCTGAGTTTGGATGCCTTGCTGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5585
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108808 Nonsense 2878 3119 23 25
ENSDART00000128292 Nonsense 2872 3113 23 25
ENSDART00000143255 Nonsense 1186 1427 21 23
ENSDART00000108808 Nonsense 2878 3119 23 25
ENSDART00000128292 Nonsense 2872 3113 23 25
ENSDART00000143255 Nonsense 1186 1427 21 23
Genomic Location:
Chromosome 10 (position 26742243)
KASP Assay ID:
554-3067.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTACTGTAACATTGAGAAGGTGTATCTGTGCACTGGAGCTGATGGATA[T/A]GTTCCTAAATACAACCCCAGCAAGTCTGAGTTTGGATGCCTTGCTGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108808 Nonsense 2890 3119 23 25
ENSDART00000128292 Nonsense 2884 3113 23 25
ENSDART00000143255 Nonsense 1198 1427 21 23
Genomic Location:
Chromosome 10 (position 26742277)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGCTGATGGATATGTTCCTAAATACAACCCCAGCAAGTCTGAGTTT[G/T]GATGCCTTGCTGACTCTCCGTCTCTGCTCTACCAATTCAAGATTATTGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/64tcdcwc