LOC100329515

Ensembl ID:
ENSDARG00000076854
Human Orthologue:
KCNA10
Human Description:
potassium voltage-gated channel, shaker-related subfamily, member 10 [Source:HGNC Symbol;Acc:6219]
Mouse Orthologue:
Kcna10
Mouse Description:
potassium voltage-gated channel, shaker-related subfamily, member 10 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7511 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7511
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113059 Missense 115 470 1 2
Genomic Location:
Chromosome 23 (position 5189012)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGATCCTTTACTACTATCAATCTGGGGGTAAGATCCGAAGGCCTGCGAA[T/A]GTACCTTTAGATGTTTTTGCAGATGAGATCATTTTCTACGAGTTGGGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uuwlvrds