NP_001128608.1

Ensembl ID:
ENSDARG00000076850
Description:
hypothetical protein LOC799552 [Source:RefSeq peptide;Acc:NP_001128608]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20780 Nonsense Available for shipment Available now
sa40763 Nonsense Mutation detected in F1 DNA During 2017
sa40762 Nonsense Mutation detected in F1 DNA During 2017
sa20779 Nonsense Available for shipment Available now
sa33923 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20780
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113196 Nonsense 216 883 2 4
Genomic Location (Zv9):
Chromosome 6 (position 40625543)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40697143
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAGCGTTCAGATTCAGTTCAAAAAAAAAGAAGAAAAAAAAAACGTTGT[A/T]AAAACATGAGGCAGAACATCAGAGTAATGGAGGACTGCTCGTCCTTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40763
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113196 Nonsense 243 883 2 4
Genomic Location (Zv9):
Chromosome 6 (position 40625462)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40697062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACTGCTCGTCCTTAAATAACAAAACAGAGGCAGACAGAGAAATTATT[G/T]AGAGGCAAACAACACAGGACACATTTGAACAAGAAAATTATTCTTCTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40762
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113196 Nonsense 667 883 2 4
Genomic Location (Zv9):
Chromosome 6 (position 40624190)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40695790
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCACGTAGAAAGTCTTTGCTTTGTTTTTCACAAAATGTATCATTGGCT[G/T]AGACTTATGATGACTTCTTCTCAGATTTTGAGGTCGGCAATTTTCTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20779
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113196 Nonsense 762 883 2 4
Genomic Location (Zv9):
Chromosome 6 (position 40623903)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40695503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGAAACCTTTCTCTGAGACATACCAAACTTCTAATGGGAAGGACGTG[G/A]TGCAGGATGGCCACCTCTTGGAGTTTTCCTAAGTCAGCCAACATTGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33923
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113196 Nonsense 781 883 2 4
Genomic Location (Zv9):
Chromosome 6 (position 40623846)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40695446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCCACCTCTTGGAGTTTTCCTAAGTCAGCCAACATTGTCTGCAATTA[C/A]GGAACAAAAACAACATTAAGTTCCTCTATAGCTCAGTCAAGTCATCCGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link