LOC560874

Ensembl ID:
ENSDARG00000076847
Human Orthologue:
TNRC6C
Human Description:
trinucleotide repeat containing 6C [Source:HGNC Symbol;Acc:29318]
Mouse Orthologue:
Tnrc6c
Mouse Description:
trinucleotide repeat containing 6C Gene [Source:MGI Symbol;Acc:MGI:2443265]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6904 Nonsense Mutation detected in F1 DNA During 2014
sa1472 Nonsense Available for shipment Available now
sa2126 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa6904
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113726 Nonsense 428 1817 4 21
Genomic Location:
Chromosome 3 (position 34363737)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATCCCAAGGAGGATCCTCGCAGGTCAACGGGGATAGGGAACCTATTTG[G/A]GGTAATGGAGATGCCAAGTCTGGTGGTGGCTCAAAAGACTCTGATTGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1472
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113726 Nonsense 664 1817 4 21
Genomic Location:
Chromosome 3 (position 34363031)
KASP Assay ID:
554-1397.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCTGGAGATTGGGGCAGCACCTCAGCTGGAGGCCCAGGAGGCAACCTG[C/T]AGAAAAGTGGTCAGACTTGGGGWTCGGAAGAGAAGTCTCCGACCTGGGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa2126
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113726 Nonsense 1640 1817 19 21
Genomic Location:
Chromosome 3 (position 34351066)
KASP Assay ID:
554-3356.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCACATGGAGTACAGACAGCTCCAGCAGGAGCACTAGCTGGCTGGTTT[T/A]GAGAAACCTCACACCTCAGGTATCGTTAAGGCTACTGTTAAGTNNNTAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fvu6yego