LOC563760

Ensembl ID:
ENSDARG00000076843
Human Orthologues:
ARSI, ARSJ
Human Descriptions:
arylsulfatase family, member I [Source:HGNC Symbol;Acc:32521]
arylsulfatase family, member J [Source:HGNC Symbol;Acc:26286]
Mouse Orthologues:
Arsi, Arsj
Mouse Descriptions:
arylsulfatase i Gene [Source:MGI Symbol;Acc:MGI:2670959]
arylsulfatase J Gene [Source:MGI Symbol;Acc:MGI:2443513]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6295 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6295
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115393 Nonsense 16 535 1 3
Genomic Location:
Chromosome 13 (position 22244881)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGGGGTAKAGTTCCCCCACATATTGTTTTCGTGATGGTGGATGACCAA[G/T]KATACAATGAYATAGGGTACCATGGCTCAGAGATCCAAACACCCGTGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zci3mafb