si:ch211-235o23.2

Ensembl ID:
ENSDARG00000076838
ZFIN IDs:
ZDB-GENE-010605-5, ZDB-GENE-010605-5, ZDB-GENE-010605-5, ZDB-GENE-010605-5, ZDB-GENE-070912-224
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S725]
Human Orthologue:
APOM
Human Description:
apolipoprotein M [Source:HGNC Symbol;Acc:13916]
Mouse Orthologue:
Apom
Mouse Description:
apolipoprotein M Gene [Source:MGI Symbol;Acc:MGI:1930124]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32997 Nonsense Available for shipment Available now
sa39906 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32997
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114951 Nonsense 82 191 2 7
ENSDART00000132617 Nonsense 80 189 2 6
ENSDART00000136690 Nonsense 94 203 2 7
ENSDART00000141358 Nonsense 106 215 2 7
Genomic Location (Zv9):
Chromosome 2 (position 42333610)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42383074
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACAGACAGCATAGTTCTTCAGATCCAGAAAAACAGCGACTCCACCCTG[A/T]AGGTCACTGAAACCATGCGCATGTGAGTGGAGAACACTGCACACAGGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39906
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114951 Essential Splice Site 114 191 3 7
ENSDART00000132617 Essential Splice Site 112 189 3 6
ENSDART00000136690 Essential Splice Site 126 203 3 7
ENSDART00000141358 Essential Splice Site 138 215 3 7
Genomic Location (Zv9):
Chromosome 2 (position 42333408)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42382872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAACTACTATGCATTGCCTGCGACAAGCCCTTTCCTGTTCAGAGAAGG[T/A]AAGAAACACTGCAATTATTTAGCTAATTTTAAATGTCCCCTAAAGTTAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link