NP_001122252.1

Ensembl ID:
ENSDARG00000076831
Description:
hypothetical protein LOC793880 [Source:RefSeq peptide;Acc:NP_001122252]
Human Orthologue:
IQCK
Human Description:
IQ motif containing K [Source:HGNC Symbol;Acc:28556]
Mouse Orthologue:
Iqck
Mouse Description:
IQ motif containing K Gene [Source:MGI Symbol;Acc:MGI:3612188]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31367 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31367
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112428 Nonsense 191 225 8 8
Genomic Location (Zv9):
Chromosome 3 (position 63022777)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 62123882
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGATGCGCTGGTGGACGGCGCGGATCCGCATGTGGAGGCTGGAGTGTA[T/G]ATTGAGGTTGTGCCGCCGACGCCGCAGAACAGAGCGCTTTACACACCGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link