bx248082.1

Ensembl ID:
ENSDARG00000076829
ZFIN ID:
ZDB-GENE-100920-6
Human Orthologue:
ANKIB1
Human Description:
ankyrin repeat and IBR domain containing 1 [Source:HGNC Symbol;Acc:22215]
Mouse Orthologue:
Ankib1
Mouse Description:
ankyrin repeat and IBR domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1918047]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2840 Nonsense F2 line generated During 2014
sa6417 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11390 Nonsense Available for shipment Available now
sa22790 Nonsense Mutation detected in F1 DNA During 2014
sa22789 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2840
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112288 Nonsense 337 1074 6 19
ENSDART00000131227 Nonsense 337 1074 7 20
Genomic Location:
Chromosome 16 (position 18135258)
KASP Assay ID:
554-2580.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATATTCACACTCAAGTTGCTGTATTTTTCCCTTTTCAGTGCGGTATTTG[T/A]ATGTGCGCTGCTTCCATGTTTGAAGAGCCTGTTGAWATTCCTTGTGGTCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa6417
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112288 Essential Splice Site 363 1074 6 19
ENSDART00000131227 Essential Splice Site 363 1074 7 20
Genomic Location:
Chromosome 16 (position 18135179)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTGAWATTCCTTGTGGTCATGAGTTCTGCAGGGGATGCTGGGAAAGG[T/A]GAGCTTTTATTTCTTTTTTTTTATTCAGTATTTTAGTCACACTGWGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11390
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112288 Nonsense 537 1074 10 19
ENSDART00000131227 Nonsense 537 1074 11 20
Genomic Location:
Chromosome 16 (position 18129495)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCCAACTGCAAATCTCCCATTCAGAAGAATGAGGGATGTAACCACATG[C/T]AATGTGCCAAGGTTATTTGCGTAATAACAATAATAGATCTATTTATAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22790
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112288 Nonsense 568 1074 11 19
ENSDART00000131227 Nonsense 568 1074 12 20
Genomic Location:
Chromosome 16 (position 18126242)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGTGGAAAAAACACAGTTCCTCTACTGGAGGGTACTACCGCTGCACA[C/T]GATATGAGGTCATTCAGCAAGTGGAGGAGCAGTCTAAAGAGATGACTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22789
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112288 Essential Splice Site 762 1074 16 19
ENSDART00000131227 Essential Splice Site 762 1074 17 20
Genomic Location:
Chromosome 16 (position 18102875)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTGGTGGAACATGGGACTGGGAGTATTTGGGTTTCGCCTCTCCTGAG[G/A]TAACATTTTTTAAGCCTGTTTTACAAACTTTGTGTTATTTGTGTCTTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qkw4jmfz