NP_001122275.1

Ensembl ID:
ENSDARG00000076828
Description:
hypothetical protein LOC798684 [Source:RefSeq peptide;Acc:NP_001122275]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19601 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19601
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111256 Nonsense 109 131 2 2
Genomic Location (Zv9):
Chromosome 1 (position 52924881)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51795480
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGGGATGCGGGAATCTGACCTTTAATGGCAAACCAGTTCAACTACAA[C/T]AGAAGCTGTGTGATCTGCAGGTGGAGCCCGGTGCTACATTCATCACCTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link