si:ch211-232k18.1

Ensembl ID:
ENSDARG00000076826
ZFIN ID:
ZDB-GENE-091204-242
Human Orthologue:
DPP6
Human Description:
dipeptidyl-peptidase 6 [Source:HGNC Symbol;Acc:3010]
Mouse Orthologue:
Dpp6
Mouse Description:
dipeptidylpeptidase 6 Gene [Source:MGI Symbol;Acc:MGI:94921]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44084 Nonsense Mutation detected in F1 DNA During 2017
sa44083 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080766 Nonsense 16 682 1 22
ENSDART00000143613   None 113 None 4
Genomic Location (Zv9):
Chromosome 24 (position 7010777)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6868069
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATCATGACCACTGCAAAGGAGTCAAATATATCGACCAAAACAGCTCAA[C/T]AGCAAGAACAGGTACTGGAGAGATTTATTTATCTTTGTTTGGTCACTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080766 Essential Splice Site 91 682 4 22
ENSDART00000143613 Essential Splice Site 73 113 3 4
Genomic Location (Zv9):
Chromosome 24 (position 6890012)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6747304
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTGACGTTCTATAGCGCTAACTCTTATCCTTTTATCCTCTCCCTTTA[G/T]ATAATGAGCTCCTCTATCGTACCCGTGAAGGTGACGTGGTTCGCTTCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link