MYOM1 (1 of 2)

Ensembl ID:
ENSDARG00000076821
Description:
myomesin 1, 185kDa [Source:HGNC Symbol;Acc:7613]
Human Orthologue:
MYOM1
Human Description:
myomesin 1, 185kDa [Source:HGNC Symbol;Acc:7613]
Mouse Orthologue:
Myom1
Mouse Description:
myomesin 1 Gene [Source:MGI Symbol;Acc:MGI:1341430]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15474 Nonsense Available for shipment Available now
sa34248 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34247 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34246 Nonsense Mutation detected in F1 DNA During 2016
sa11567 Nonsense Available for shipment Available now
sa21150 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15474
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087099 Nonsense 675 1656 20 43
Genomic Location (Zv9):
Chromosome 7 (position 74389198)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71534588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACAGACAGCTGGCAGCGAGTGAACACTGAAATCCCAGTGAAATCTCCA[C/T]GMTTTGCTCTCTTTGATCYGGCCGAGGGCAAATCTTACCRCTTCAGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34248
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087099 Essential Splice Site 1214 1656 29 43
Genomic Location (Zv9):
Chromosome 7 (position 74375038)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71520428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGACACACACTGATGGAGCGTCTGCCAGCTACACGTTCTCTGAAGAAG[G/A]TCGGATTATCTGTTTTCTGCTTTTTTGTTTTTGTATTTATAAGTGTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34247
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087099 Essential Splice Site 1276 1656 32 43
Genomic Location (Zv9):
Chromosome 7 (position 74370767)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71516157
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAGGTAATAATAATACATTTTAAACTAAACTACTCCGGTGTGTTGTA[G/T]AAATACAAGATGAACTTTGACAAAAACACTGGCATCATTGAGATGTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34246
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087099 Nonsense 1339 1656 33 43
Genomic Location (Zv9):
Chromosome 7 (position 74370485)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71515875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGTGTTTAAGCAGTTGCAGAAGGAATCAGAGTTTCAGAGGAAAGAATG[G/A]CATAGAAAGCAAGGTATGAGTATAGTGTATGCACTAAAATATTATGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11567
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087099 Nonsense 1378 1656 35 43
Genomic Location (Zv9):
Chromosome 7 (position 74369090)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71514480
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATCTGKGCTGTAGGTTGGKAACATGAAGAAAGACTCGACGGCRTTGTG[G/A]TATAAAGATGGACGGGAGGTGAAGGTCGACGAAAAACTGGATTTCTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21150
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087099 Nonsense 1379 1656 35 43
Genomic Location (Zv9):
Chromosome 7 (position 74369087)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71514477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTGCTGTAGGTTGGTAACATGAAGAAAGACTCGACGGCGTTGTGGTA[T/G]AAAGATGGACGGGAGGTGAAGGTCGACGAAAAACTGGATTTCTCTGAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link