LOC100149957

Ensembl ID:
ENSDARG00000076820
Human Orthologue:
XKR8
Human Description:
XK, Kell blood group complex subunit-related family, member 8 [Source:HGNC Symbol;Acc:25508]
Mouse Orthologue:
Xkr8
Mouse Description:
X Kell blood group precursor related family member 8 homolog Gene [Source:MGI Symbol;Acc:MGI:2685877

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23528 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23528
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032374 Nonsense 250 313 2 2
Genomic Location:
Chromosome 19 (position 25480781)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGTATGTTAAATCCTTATATAGTGGTTCCAACACTACTGGGTTTGTA[T/A]GTGATTGGAATTCTAGTGGAAATAATATACTACAGATGGTTTCATCCTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cfibgepn