eif3s10

Ensembl ID:
ENSDARG00000076815
ZFIN ID:
ZDB-GENE-030131-5726
Description:
Eukaryotic translation initiation factor 3 subunit A [Source:UniProtKB/Swiss-Prot;Acc:Q6PCR7]
Human Orthologue:
EIF3A
Human Description:
eukaryotic translation initiation factor 3, subunit A [Source:HGNC Symbol;Acc:3271]
Mouse Orthologue:
Eif3a
Mouse Description:
eukaryotic translation initiation factor 3, subunit A Gene [Source:MGI Symbol;Acc:MGI:95301]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17336 Essential Splice Site Available for shipment Available now
sa35460 Nonsense Available for shipment Available now
sa9822 Essential Splice Site Available for shipment Available now
sa30668 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17336
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111462 Essential Splice Site 181 1267 4 22

The following transcripts of ENSDARG00000076815 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 19341423)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 19165535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAATAACTCCAAAGTGGAGCGTCTTTACCATGACATTGCTCAGCAAGG[T/G]CAGTGAGGACAAAACCACCTGCTTATTGGAGTTTAAGCAAAWGGTACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35460
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111462 Nonsense 205 1267 5 22

The following transcripts of ENSDARG00000076815 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 19341885)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 19165997
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTCGTAAAGCAGAGTTCCGTAAGCTGTGTGACAACCTGCGAATGCACT[T/A]GGGGCAAATCCAGAGGCATCACAACCAGAGCACTGCCATCAACCTCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9822
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111462 Essential Splice Site 442 1267 9 22

The following transcripts of ENSDARG00000076815 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 19348167)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 19172279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTATGTTCCTCACCTGCAGAACAACACAATCCTCAGACTGCTGCAACAA[G/A]TTGGTTTAATCTACCCCCAGATTACCTGTTTGAAGAATGTGTGCCTGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30668
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111462 Nonsense 1061 1267 19 22

The following transcripts of ENSDARG00000076815 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 19351697)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 19175809
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAACCTAGAGGCCCTCGTCGTGGTGCAGATGATGACTGGGGCCCCAGA[A/T]GAGGGGGAGATGATGAGAGGGGGGGCCGCAGGGGTATGGATGACTCCGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link