ptprfa

Ensembl ID:
ENSDARG00000076810
ZFIN ID:
ZDB-GENE-020107-2
Description:
Receptor protein-tyrosine phosphatase LAR [Source:UniProtKB/TrEMBL;Acc:Q90YJ5]
Human Orthologue:
PTPRF
Human Description:
protein tyrosine phosphatase, receptor type, F [Source:HGNC Symbol;Acc:9670]
Mouse Orthologue:
Ptprf
Mouse Description:
protein tyrosine phosphatase, receptor type, F Gene [Source:MGI Symbol;Acc:MGI:102695]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18650 Essential Splice Site Available for shipment Available now
sa10718 Nonsense Available for shipment Available now
sa20608 Nonsense Available for shipment Available now
sa10963 Nonsense Available for shipment Available now
sa20609 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18650
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026738 Essential Splice Site 511 1893 7 31
ENSDART00000142544   None 1186 None 21

The following transcripts of ENSDARG00000076810 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 2949914)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 2962614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGATGGACCACCTTCCGATATACTGCAGGTTAAAACACAGCAAGGAGG[T/G]GAGATGTGTGCTTATAWATACAGTTGAGGTCASATGCAACAAAAGACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10718
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026738 Nonsense 519 1893 8 31
ENSDART00000142544   None 1186 None 21

The following transcripts of ENSDARG00000076810 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 2950073)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 2962773
KASP Assay ID:
2259-7012.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACNTTTTTTTGCATTTATTCATGCAGTCCCTGCTCAGCCGACTGGTTTT[G/T]AAGCTGAAGCCGAGTTGGACACGCGRATCATGCTGTCATGGTTGTGGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026738 Nonsense 768 1893 11 31
ENSDART00000142544 Nonsense 63 1186 1 21

The following transcripts of ENSDARG00000076810 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 2974063)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3006831
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATGGAGAGCCGCGCGGACAGCCCATCATTCTGGACGTGGCGCTGCCA[G/T]AGGCACAGGTACACTGCGCAAACACAACACTGTAAATCAGTCCAGACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10963
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026738 Nonsense 878 1893 13 31
ENSDART00000142544 Nonsense 171 1186 3 21

The following transcripts of ENSDARG00000076810 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 3003785)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3036553
KASP Assay ID:
2259-7015.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCACTGATGACCACTTCACTGTCACCGGCCTGCACAARGGCGCGACGTA[C/A]ATCTTCAAACTCTGCGCTAAAAACCGCGCCGGGAATGGAGAGGAGTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20609
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026738 Essential Splice Site 1443 1893 22 31
ENSDART00000142544 Essential Splice Site 736 1186 12 21

The following transcripts of ENSDARG00000076810 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 3056461)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3089229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAACCAGCACTATCGTCATGATGACCCGACTGGAGGAGAAGAGCAGG[G/A]TGAGATTATATATAATATCTGCCTGCCTTGCTAACATACACAAACACGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link