arap3

Ensembl ID:
ENSDARG00000076801
ZFIN ID:
ZDB-GENE-091019-1
Human Orthologue:
ARAP3
Human Description:
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3 [Source:HGNC Symbol;Acc:24097]
Mouse Orthologue:
Arap3
Mouse Description:
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3 Gene [Source:MGI Symbol;Acc:MGI:2147274]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3880 Nonsense Mutation detected in F1 DNA During 2014
sa12354 Nonsense Available for shipment Available now
sa16286 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3880
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042624 Nonsense 25 1664 1 33
Genomic Location:
Chromosome 14 (position 27594589)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGTGCTCAGATGCAGAGGACCTGTTGGCTTCCATCCACCTGGAGAGGTA[T/A]CTGGACCACTTCCGTCAGGCAGGCTTTCTTCTYGCCCGAGACTTCTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12354
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042624 Nonsense 586 1664 9 33
Genomic Location:
Chromosome 14 (position 27604138)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NCTTTTGTGTTTCACAGTGCTTTAAAAATGGGATTGGAATTACAGTAATT[G/T]AGGCGAGAGGTGCTACAATTCGTGATGGGAAGGGCAAGAGCTTTGATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16286
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042624 Nonsense 907 1664 16 33
Genomic Location:
Chromosome 14 (position 27612571)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTAAWAAKCTKACTCTTGATGTTTTTCTCAGATTTCGCTACACTTTT[G/T]AACTTTACCTAATGTCTGATAAACTGGTCCAGTTTGGCTTGGAGACTCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/an7v6dgt