arap3

Ensembl ID:
ENSDARG00000076801
ZFIN ID:
ZDB-GENE-091019-1
Human Orthologue:
ARAP3
Human Description:
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3 [Source:HGNC Symbol;Acc:24097]
Mouse Orthologue:
Arap3
Mouse Description:
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3 Gene [Source:MGI Symbol;Acc:MGI:2147274]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35696 Nonsense Mutation detected in F1 DNA During 2016
sa12354 Nonsense Available for shipment Available now
sa35697 Essential Splice Site Mutation detected in F1 DNA During 2016
sa16286 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35696
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042624 Nonsense 17 1664 1 33
Genomic Location (Zv9):
Chromosome 14 (position 27594564)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26287361
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGCACACTATGGCAACAATCGGTCCGTGCTCAGATGCAGAGGACCTGT[T/A]GGCTTCCATCCACCTGGAGAGGTATCTGGACCACTTCCGTCAGGCAGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12354
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042624 Nonsense 586 1664 9 33
Genomic Location (Zv9):
Chromosome 14 (position 27604138)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26296935
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NCTTTTGTGTTTCACAGTGCTTTAAAAATGGGATTGGAATTACAGTAATT[G/T]AGGCGAGAGGTGCTACAATTCGTGATGGGAAGGGCAAGAGCTTTGATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35697
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042624 Essential Splice Site 901 1664 15 33
Genomic Location (Zv9):
Chromosome 14 (position 27612469)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26305266
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGGAGTCAGCAGGCCAGACTCCAGCAACAACAGCGGCTTTATTGACAA[G/A]TGAGAGCCACTGCTAACCAACATCCCTCAGGACATTTAAACATTAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16286
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042624 Nonsense 907 1664 16 33
Genomic Location (Zv9):
Chromosome 14 (position 27612571)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26305368
KASP Assay ID:
2260-7601.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTAAWAAKCTKACTCTTGATGTTTTTCTCAGATTTCGCTACACTTTT[G/T]AACTTTACCTAATGTCTGATAAACTGGTCCAGTTTGGCTTGGAGACTCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link