si:ch211-261p9.4

Ensembl ID:
ENSDARG00000076798
ZFIN ID:
ZDB-GENE-081104-205
Description:
Novel protein similar to H.sapiens C3orf38, chromosome 3 open reading frame 38 (C3orf38) [Source:Uni
Human Orthologue:
C3orf38
Human Description:
chromosome 3 open reading frame 38 [Source:HGNC Symbol;Acc:28384]
Mouse Orthologue:
4930453N24Rik
Mouse Description:
RIKEN cDNA 4930453N24 gene Gene [Source:MGI Symbol;Acc:MGI:1914859]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9465 Nonsense Available for shipment Available now
sa41381 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9465
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113349 Nonsense 135 320 6 8
ENSDART00000136493   None 89 None 2
ENSDART00000143122   None 165 None 1
Genomic Location (Zv9):
Chromosome 9 (position 16333243)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 16310388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTTTTTNAANCCAGATATCAAAGCCTGAGAGGAATACARACAATTCCTA[T/A]GAGGTTGGAGATGGTCTATCAGACCTTGCAGCATTGGGAAAACAGTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41381
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113349 Nonsense 197 320 6 8
ENSDART00000136493   None 89 None 2
ENSDART00000143122 Nonsense 55 165 1 1
Genomic Location (Zv9):
Chromosome 9 (position 16333059)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 16310572
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATGTGAGCCTTCGGCTTCTCTTGTGCACCGGAGAGCAGCGTGTTGAT[G/T]AGTTCAGTGGGGCAGAACTTGTCAGCAAGCGGCTTCAAGCTCTTGCAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link