LOC100334775

Ensembl ID:
ENSDARG00000076795
Human Orthologue:
LPHN1
Human Description:
latrophilin 1 [Source:HGNC Symbol;Acc:20973]
Mouse Orthologue:
Lphn1
Mouse Description:
latrophilin 1 Gene [Source:MGI Symbol;Acc:MGI:1929461]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1986 Essential Splice Site F2 line generated During 2015
sa25716 Essential Splice Site Mutation detected in F1 DNA During 2015
sa25715 Nonsense Mutation detected in F1 DNA During 2015
sa15599 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1986
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114576 Essential Splice Site 18 390 1 6
Genomic Location:
Chromosome 1 (position 59550841)
KASP Assay ID:
554-2833.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGARGCTCCAGACAGCAGCTCTGACTYTCTCTGCTCTCCTCTGCGCAGG[T/G]CACRCTTTATTTATTCACTCTTTCTGCTCATTATGAWGTTGTGAATATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114576 Essential Splice Site 67 390 3 6
Genomic Location:
Chromosome 1 (position 59546680)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCATCCCCTGCTCCTGCTAATACTCCTCTATTATGGCTCTGTCTCTGC[A/T]GTTTTTGTCTGTCCTGGAACACTGGTGCGCGTGCTGGAGCCCAGTTCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25715
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114576 Nonsense 103 390 3 6
Genomic Location:
Chromosome 1 (position 59546571)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGAGGATCATTCGGGGGCGTGGTGTAAAGACCCCCTGCAGGCGGGCGAT[A/T]GACTGTATGTGATGCCCTGGACGCCCTATCGCACCGACATGCTGTATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15599
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114576 Nonsense 135 390 3 6
Genomic Location:
Chromosome 1 (position 59546473)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATACGCCTCCTGGGACGACTACATTCAAAAYAGAGTCACCACCAYGTA[T/A]AAGTGAGYTTCACAGTGTCTRTTTATYCTTTGATYAARTGTAATCAAGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Mortality among heart failure patients: Genomic variation associated with mortality among adults of European and African ancestry with heart failure: the cohorts for heart and aging research in genomic epidemiology consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dyvo2iim