LOC100334775

Ensembl ID:
ENSDARG00000076795
Human Orthologue:
LPHN1
Human Description:
latrophilin 1 [Source:HGNC Symbol;Acc:20973]
Mouse Orthologue:
Lphn1
Mouse Description:
latrophilin 1 Gene [Source:MGI Symbol;Acc:MGI:1929461]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1986 Essential Splice Site F2 line generated During 2016
sa25716 Essential Splice Site Mutation detected in F1 DNA During 2016
sa25715 Nonsense Mutation detected in F1 DNA During 2016
sa32807 Nonsense Mutation detected in F1 DNA During 2016
sa15599 Nonsense Available for shipment Available now
sa38303 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa1986
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114576 Essential Splice Site 18 390 1 6
Genomic Location (Zv9):
Chromosome 1 (position 59550841)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 58002806
KASP Assay ID:
554-2833.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGARGCTCCAGACAGCAGCTCTGACTYTCTCTGCTCTCCTCTGCGCAGG[T/G]CACRCTTTATTTATTCACTCTTTCTGCTCATTATGAWGTTGTGAATATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114576 Essential Splice Site 67 390 3 6
Genomic Location (Zv9):
Chromosome 1 (position 59546680)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57998645
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCATCCCCTGCTCCTGCTAATACTCCTCTATTATGGCTCTGTCTCTGC[A/T]GTTTTTGTCTGTCCTGGAACACTGGTGCGCGTGCTGGAGCCCAGTTCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25715
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114576 Nonsense 103 390 3 6
Genomic Location (Zv9):
Chromosome 1 (position 59546571)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57998536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGAGGATCATTCGGGGGCGTGGTGTAAAGACCCCCTGCAGGCGGGCGAT[A/T]GACTGTATGTGATGCCCTGGACGCCCTATCGCACCGACATGCTGTATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32807
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114576 Nonsense 126 390 3 6
Genomic Location (Zv9):
Chromosome 1 (position 59546500)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57998465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCCCTATCGCACCGACATGCTGTATGAATACGCCTCCTGGGACGACTA[C/A]ATTCAAAACAGAGTCACCACCACGTATAAGTGAGTTTCACAGTGTCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15599
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114576 Nonsense 135 390 3 6
Genomic Location (Zv9):
Chromosome 1 (position 59546473)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57998438
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATACGCCTCCTGGGACGACTACATTCAAAAYAGAGTCACCACCAYGTA[T/A]AAGTGAGYTTCACAGTGTCTRTTTATYCTTTGATYAARTGTAATCAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38303
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114576 Nonsense 166 390 4 6
Genomic Location (Zv9):
Chromosome 1 (position 59545141)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57997106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGGCGCCGTGTTCTACAATAAGGAGCGAACGCGCAACATAGTGAAATA[T/G]GACCTGCGAACTCGCATCAAGAGCGGCGAAGCTGTTATTGTGAATGCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Mortality among heart failure patients: Genomic variation associated with mortality among adults of European and African ancestry with heart failure: the cohorts for heart and aging research in genomic epidemiology consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link