cdk13

Ensembl ID:
ENSDARG00000076791
ZFIN ID:
ZDB-GENE-030131-4975
Human Orthologue:
CDK13
Human Description:
cyclin-dependent kinase 13 [Source:HGNC Symbol;Acc:1733]
Mouse Orthologue:
Cdk13
Mouse Description:
cyclin-dependent kinase 13 Gene [Source:MGI Symbol;Acc:MGI:1916812]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8028 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8028
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114544 Essential Splice Site 512 1289 None 14

The following transcripts of ENSDARG00000076791 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 1015770)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACACACACCCGCAGCCAACAACATGGAGCATCTGGAGGCCAACGACAGG[T/C]ACAGTTCCGCTAAACTGTTCGCCCTCCTGWGATTTNGTTTCTYCATGAAGY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hwpujce2