cx32.2

Ensembl ID:
ENSDARG00000076789
ZFIN ID:
ZDB-GENE-050303-1
Description:
Gap junction Cx32.2 protein [Source:UniProtKB/Swiss-Prot;Acc:Q7T047]
Human Orthologues:
GJA1, GJA3, GJA4, GJA5, GJA8
Human Descriptions:
gap junction protein, alpha 1, 43kDa [Source:HGNC Symbol;Acc:4274]
gap junction protein, alpha 3, 46kDa [Source:HGNC Symbol;Acc:4277]
gap junction protein, alpha 4, 37kDa [Source:HGNC Symbol;Acc:4278]
gap junction protein, alpha 5, 40kDa [Source:HGNC Symbol;Acc:4279]
gap junction protein, alpha 8, 50kDa [Source:HGNC Symbol;Acc:4281]
Mouse Orthologues:
Gja1, Gja3, Gja4, Gja5, Gja6, Gja8
Mouse Descriptions:
gap junction protein, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:95713]
gap junction protein, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:95714]
gap junction protein, alpha 4 Gene [Source:MGI Symbol;Acc:MGI:95715]
gap junction protein, alpha 5 Gene [Source:MGI Symbol;Acc:MGI:95716]
gap junction protein, alpha 6 Gene [Source:MGI Symbol;Acc:MGI:95717]
gap junction protein, alpha 8 Gene [Source:MGI Symbol;Acc:MGI:99953]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa995 Nonsense Available for shipment Available now
sa17698 Nonsense Available for shipment Available now
sa17779 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa995
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101014 Nonsense 48 277 2 2
ENSDART00000122580 Nonsense 48 277 1 1
Genomic Location:
Chromosome 20 (position 40756705)
KASP Assay ID:
554-0899.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTCCGCATCTTGGTGTTGGGAGCAGGAGCCGAGAATGTTTGGGGCGAC[G/T]AAAGATCCAACTTRGTGTGCAACACCAACACCCCTGGCTGCGATAACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17698
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101014 Nonsense 184 277 2 2
ENSDART00000122580 Nonsense 184 277 1 1
ENSDART00000101014 Nonsense 184 277 2 2
ENSDART00000122580 Nonsense 184 277 1 1
Genomic Location:
Chromosome 20 (position 40756297)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTCATCTGTGAAAGGTCACCCTGTATGAGGGCTGAGTGTTTCGTGTCC[A/T]GACCCACGGAGAAAAGCATCTTCATTATCTTCATRCTGGTGGTGGCTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17779
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101014 Nonsense 184 277 2 2
ENSDART00000122580 Nonsense 184 277 1 1
ENSDART00000101014 Nonsense 184 277 2 2
ENSDART00000122580 Nonsense 184 277 1 1
Genomic Location:
Chromosome 20 (position 40756297)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTCATCTGTGAAAGGTCACCCTGTATGAGGGCTGAGTGTTTCGTGTCC[A/T]GACCCACGGAGAAAAGCATCTTCATTATCTTCATRCTGGTGGTGGCTTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pl17dpod